View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1362_low_57 (Length: 277)

Name: NF1362_low_57
Description: NF1362
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1362_low_57
NF1362_low_57
[»] chr6 (1 HSPs)
chr6 (135-277)||(428025-428167)


Alignment Details
Target: chr6 (Bit Score: 143; Significance: 3e-75; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 135 - 277
Target Start/End: Complemental strand, 428167 - 428025
Alignment:
Q  135 tacttgctcaggccactcagaagaaatttcggacatcaactcaatgattttactgctgatgacattcaatattttaccaatgacttgtgtcatacgtaag 234  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  428167 tacttgctcaggccactcagaagaaatttcggacatcaactcaatgattttactgctgatgacattcaatattttaccaatgacttgtgtcatacgtaag 428068  T
Q  235 tatttgatcccaaacttcaaactcgtaaatcatttaaagacga 277  Q
    |||||||||||||||||||||||||||||||||||||||||||    
T  428067 tatttgatcccaaacttcaaactcgtaaatcatttaaagacga 428025  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University