View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13628_high_13 (Length: 272)

Name: NF13628_high_13
Description: NF13628
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13628_high_13
NF13628_high_13
[»] chr7 (1 HSPs)
chr7 (18-253)||(22986177-22986408)


Alignment Details
Target: chr7 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 18 - 253
Target Start/End: Original strand, 22986177 - 22986408
Alignment:
Q  18 atgtagaaggtcaaaaaggattttgagagaatggttttttgaacgttgacctctgctgaggttagggttctgatcatcatcatcaccatttttctggcca 117  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  22986177 atgtagaaggtcaaaaaggattttgagagaatggttttttgaacgttgacctctgctgaggttagggttctgatcatcatcatcaccatttttctggcca 22986276  T
Q  118 taatccaccgttataacactgctgcgcgcggttcagccatgtcctttgactggtaggctgaatttgctgccccgacagctccctcttcttcagcgtagtt 217  Q
        ||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||| ||||||||||||| |||||| | |    
T  22986277 ----ccaccgttataacactgctgcgcgcggttcaaccatgtcctttgactggtaggatgaatttgctgccccgatagctccctcttctgcagcgtgggt 22986372  T
Q  218 gcagcctccaccttcagctgcggttccaccaccatt 253  Q
    ||||||||||||||||||||||||||||||||||||    
T  22986373 gcagcctccaccttcagctgcggttccaccaccatt 22986408  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University