View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1361_low_22 (Length: 310)

Name: NF1361_low_22
Description: NF1361
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1361_low_22
NF1361_low_22
[»] scaffold0197 (1 HSPs)
scaffold0197 (81-216)||(6061-6196)


Alignment Details
Target: scaffold0197 (Bit Score: 136; Significance: 6e-71; HSPs: 1)
Name: scaffold0197
Description:

Target: scaffold0197; HSP #1
Raw Score: 136; E-Value: 6e-71
Query Start/End: Original strand, 81 - 216
Target Start/End: Complemental strand, 6196 - 6061
Alignment:
Q  81 aatatggtgaaggaaagtggcatagggttccactattggctggtaaaagttaatcaattatttttcctttttcttgatatttctatttgtcttctctaaa 180  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  6196 aatatggtgaaggaaagtggcatagggttccactattggctggtaaaagttaatcaattatttttcctttttcttgatatttctatttgtcttctctaaa 6097  T
Q  181 acggatatttaattacttctttgaagtatgtcatct 216  Q
    ||||||||||||||||||||||||||||||||||||    
T  6096 acggatatttaattacttctttgaagtatgtcatct 6061  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University