View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13608_low_11 (Length: 241)

Name: NF13608_low_11
Description: NF13608
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13608_low_11
NF13608_low_11
[»] chr4 (2 HSPs)
chr4 (112-165)||(9945876-9945929)
chr4 (192-222)||(9945927-9945957)
[»] chr2 (1 HSPs)
chr2 (115-169)||(28849565-28849619)


Alignment Details
Target: chr4 (Bit Score: 50; Significance: 9e-20; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 112 - 165
Target Start/End: Original strand, 9945876 - 9945929
Alignment:
Q  112 tccaatgggagtgatgcatatgtgattaatctcaacgaaaagacatgtgcatgt 165  Q
    ||||||||||||||||||||||||||||||||||| ||||||||||||||||||    
T  9945876 tccaatgggagtgatgcatatgtgattaatctcaaagaaaagacatgtgcatgt 9945929  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 192 - 222
Target Start/End: Original strand, 9945927 - 9945957
Alignment:
Q  192 tgtcctcactcaattgcttgtatatggtaca 222  Q
    |||||||||||||||||||||||||||||||    
T  9945927 tgtcctcactcaattgcttgtatatggtaca 9945957  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 115 - 169
Target Start/End: Complemental strand, 28849619 - 28849565
Alignment:
Q  115 aatgggagtgatgcatatgtgattaatctcaacgaaaagacatgtgcatgtagaa 169  Q
    ||||| |||||| | ||||||||||||||||| || | |||||||||||||||||    
T  28849619 aatggaagtgatacttatgtgattaatctcaaagagaggacatgtgcatgtagaa 28849565  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University