View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1358_high_140 (Length: 203)

Name: NF1358_high_140
Description: NF1358
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1358_high_140
NF1358_high_140
[»] chr4 (1 HSPs)
chr4 (3-126)||(2246538-2246661)


Alignment Details
Target: chr4 (Bit Score: 108; Significance: 2e-54; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 108; E-Value: 2e-54
Query Start/End: Original strand, 3 - 126
Target Start/End: Original strand, 2246538 - 2246661
Alignment:
Q  3 tttttaaatatctcttatgatatgtattttgaaagaaataaaatatgatctacttaaacattttttatccaggtttacttcactaaaactaatcctcgtt 102  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||    
T  2246538 tttttaaatatctcttatgatatgtattttgaaagaaataaaatatgatctacttaaacattttttaaccaggtttacttcactaaaactaatcctcgtt 2246637  T
Q  103 gaccacctttagtataatctaccc 126  Q
    ||||||||| ||||| || |||||    
T  2246638 gaccaccttcagtatgatttaccc 2246661  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University