View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13583_high_14 (Length: 300)

Name: NF13583_high_14
Description: NF13583
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13583_high_14
NF13583_high_14
[»] chr8 (2 HSPs)
chr8 (117-289)||(37086131-37086303)
chr8 (16-52)||(37086368-37086404)


Alignment Details
Target: chr8 (Bit Score: 173; Significance: 5e-93; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 173; E-Value: 5e-93
Query Start/End: Original strand, 117 - 289
Target Start/End: Complemental strand, 37086303 - 37086131
Alignment:
Q  117 acagacaaggataatgatggaaaaagagaggcttgaatggcttccgaatcatttaaagatgctgaagatggacaatgacttcgattcggttgaggaaagg 216  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  37086303 acagacaaggataatgatggaaaaagagaggcttgaatggcttccgaatcatttaaagatgctgaagatggacaatgacttcgattcggttgaggaaagg 37086204  T
Q  217 gaatgttactattgcttctatgacttgcacctctctgctgttggttgcgagtgctttcctgacaactattcat 289  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  37086203 gaatgttactattgcttctatgacttgcacctctctgctgttggttgcgagtgctttcctgacaactattcat 37086131  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 16 - 52
Target Start/End: Complemental strand, 37086404 - 37086368
Alignment:
Q  16 ttcatatatttagaaaaatccgtaaaactttggatgg 52  Q
    |||||||||||||||||||||||||||||||| ||||    
T  37086404 ttcatatatttagaaaaatccgtaaaactttgtatgg 37086368  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University