View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13571_high_4 (Length: 327)

Name: NF13571_high_4
Description: NF13571
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13571_high_4
NF13571_high_4
[»] chr2 (1 HSPs)
chr2 (216-327)||(9450968-9451077)


Alignment Details
Target: chr2 (Bit Score: 97; Significance: 1e-47; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 97; E-Value: 1e-47
Query Start/End: Original strand, 216 - 327
Target Start/End: Original strand, 9450968 - 9451077
Alignment:
Q  216 agacataggttataatagcctgccttacttttagaaatttgattttcatggcaaacaaagaaaattgggatgaaaaccacaatcccaataagctttatta 315  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||  ||||||||||||||||| ||||||||||||||||||||||||    
T  9450968 agacataggttataatagcctgccttacttttagaaatttgattttcatggcaaac--agaaaattgggatgaaagccacaatcccaataagctttatta 9451065  T
Q  316 tcattgtttatt 327  Q
    ||||||||||||    
T  9451066 tcattgtttatt 9451077  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University