View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13568_low_12 (Length: 222)

Name: NF13568_low_12
Description: NF13568
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13568_low_12
NF13568_low_12
[»] chr7 (1 HSPs)
chr7 (22-211)||(8284677-8284866)
[»] chr4 (2 HSPs)
chr4 (38-185)||(34694753-34694900)
chr4 (35-102)||(34686910-34686977)


Alignment Details
Target: chr7 (Bit Score: 138; Significance: 3e-72; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 22 - 211
Target Start/End: Complemental strand, 8284866 - 8284677
Alignment:
Q  22 cattaggcactacttcattaatatgattctccacagggaaagagaaaaatgggggtgtaggtagttgtaaatcggtttcagtagggatgcgaaaataagc 121  Q
    |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||| |  ||||||||||    
T  8284866 cattaggcactacttcattaatatgattctgcacagggaaagagaaaaatgggggtgtaggtagttgtaaatcggttccagtaggggtttgaaaataagc 8284767  T
Q  122 atcaacttggttttggttcacggacaccgcgggtgaattagaaaacaccgccatcccatcattagcattagagtatccaatattcttcga 211  Q
    ||||||||||||||||||||| || || ||||||||||||||||||||| ||||||||||||||||||| ||| |||| ||||| |||||    
T  8284766 atcaacttggttttggttcaccgagactgcgggtgaattagaaaacaccaccatcccatcattagcattggagaatccgatattgttcga 8284677  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 48; Significance: 1e-18; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 38 - 185
Target Start/End: Complemental strand, 34694900 - 34694753
Alignment:
Q  38 attaatatgattctccacagggaaagagaaaaatgggggtgtaggtagttgtaaatcggtttcagtagggatgcgaaaataagcatcaacttggttttgg 137  Q
    ||||||||||||||| || ||||||||| |||||||||||||||||||||||| | ||||| ||||  || || ||  ||||| |||| |||| ||||||    
T  34694900 attaatatgattctcaaccgggaaagaggaaaatgggggtgtaggtagttgtagaccggttccagtgagggtgtgaggataagtatcatcttgattttgg 34694801  T
Q  138 ttcacggacaccgcgggtgaattagaaaacaccgccatcccatcatta 185  Q
    ||||  || |  |||||||||||||  | || | ||||||||||||||    
T  34694800 ttcagagatattgcgggtgaattaggcaccatcaccatcccatcatta 34694753  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 35 - 102
Target Start/End: Complemental strand, 34686977 - 34686910
Alignment:
Q  35 ttcattaatatgattctccacagggaaagagaaaaatgggggtgtaggtagttgtaaatcggtttcag 102  Q
    |||||||||||||||||| || |||||||||  ||||||||||||||||||||||| | |||||||||    
T  34686977 ttcattaatatgattctcaaccgggaaagagggaaatgggggtgtaggtagttgtagaccggtttcag 34686910  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University