View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13561_low_27 (Length: 256)

Name: NF13561_low_27
Description: NF13561
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13561_low_27
NF13561_low_27
[»] chr7 (1 HSPs)
chr7 (17-201)||(15591964-15592148)


Alignment Details
Target: chr7 (Bit Score: 181; Significance: 7e-98; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 181; E-Value: 7e-98
Query Start/End: Original strand, 17 - 201
Target Start/End: Original strand, 15591964 - 15592148
Alignment:
Q  17 caaaggaggcaaggtattcaatagaacaacataacataacacgaataagggttacccatattatcatacataatatcattcaataataacactaatcaat 116  Q
    |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  15591964 caaaggaggcaaggtattcaatagaacaacataacataacacaaataagggttacccatattatcatacataatatcattcaataataacactaatcaat 15592063  T
Q  117 ctaactaatgcgaattcaatgatatctattaaaataaaattctaatcaatggattaacttgtatcgtaagtaatccagatgcatt 201  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  15592064 ctaactaatgcgaattcaatgatatctattaaaataaaattctaatcaatggattaacttgtatcgtaagtaatccagatgcatt 15592148  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University