View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13539_high_1 (Length: 296)

Name: NF13539_high_1
Description: NF13539
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13539_high_1
NF13539_high_1
[»] chr6 (4 HSPs)
chr6 (217-266)||(595534-595583)
chr6 (213-262)||(841946-841995)
chr6 (210-259)||(5014169-5014218)
chr6 (227-256)||(13850509-13850538)
[»] chr3 (12 HSPs)
chr3 (213-266)||(498028-498081)
chr3 (213-266)||(50385860-50385913)
chr3 (215-262)||(43055605-43055652)
chr3 (213-258)||(22418556-22418601)
chr3 (213-265)||(53446022-53446074)
chr3 (213-256)||(49430633-49430676)
chr3 (227-265)||(24758602-24758640)
chr3 (227-265)||(24767599-24767637)
chr3 (226-259)||(2125280-2125313)
chr3 (226-259)||(26555492-26555525)
chr3 (226-259)||(28211742-28211775)
chr3 (217-265)||(29694310-29694358)
[»] chr8 (3 HSPs)
chr8 (213-265)||(29247171-29247223)
chr8 (214-258)||(33619647-33619691)
chr8 (226-259)||(28535209-28535242)
[»] chr7 (10 HSPs)
chr7 (213-265)||(46913458-46913510)
chr7 (208-258)||(28998018-28998068)
chr7 (213-267)||(41969780-41969834)
chr7 (213-262)||(42897753-42897802)
chr7 (213-248)||(36617052-36617087)
chr7 (232-265)||(19815130-19815163)
chr7 (226-259)||(38663019-38663052)
chr7 (213-254)||(46358015-46358056)
chr7 (225-261)||(46437321-46437357)
chr7 (227-255)||(46457998-46458026)
[»] chr1 (9 HSPs)
chr1 (213-265)||(2123853-2123905)
chr1 (213-265)||(38740986-38741038)
chr1 (213-262)||(50158592-50158641)
chr1 (213-265)||(33403427-33403479)
chr1 (227-265)||(32940712-32940750)
chr1 (213-258)||(37187914-37187959)
chr1 (225-264)||(5458825-5458864)
chr1 (217-262)||(29702453-29702498)
chr1 (225-259)||(18431711-18431745)
[»] chr5 (8 HSPs)
chr5 (213-264)||(34225679-34225730)
chr5 (213-265)||(25981138-25981190)
chr5 (219-266)||(3058969-3059016)
chr5 (213-265)||(14396094-14396152)
chr5 (213-259)||(18113834-18113880)
chr5 (214-262)||(2197413-2197464)
chr5 (213-259)||(424832-424878)
chr5 (232-265)||(39421044-39421077)
[»] chr4 (5 HSPs)
chr4 (213-266)||(2917951-2918004)
chr4 (213-262)||(51513128-51513177)
chr4 (213-267)||(28323076-28323130)
chr4 (213-267)||(46672851-46672905)
chr4 (213-250)||(4939939-4939976)
[»] chr2 (4 HSPs)
chr2 (67-120)||(28654781-28654834)
chr2 (1-52)||(28668193-28668244)
chr2 (210-262)||(37622828-37622880)
chr2 (1-44)||(28676841-28676883)


Alignment Details
Target: chr6 (Bit Score: 50; Significance: 1e-19; HSPs: 4)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 217 - 266
Target Start/End: Original strand, 595534 - 595583
Alignment:
Q  217 ggatccacagtgaaacatggtgtggcagttgccacaccagattattccct 266  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||    
T  595534 ggatccacagtgaaacatggtgtggcagttgccacaccagattattccct 595583  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 213 - 262
Target Start/End: Original strand, 841946 - 841995
Alignment:
Q  213 gggcggatccacagtgaaacatggtgtggcagttgccacaccagattatt 262  Q
    |||||||||||| ||||||||||||||||||||||| |||||||||||||    
T  841946 gggcggatccaccgtgaaacatggtgtggcagttgcaacaccagattatt 841995  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 210 - 259
Target Start/End: Complemental strand, 5014218 - 5014169
Alignment:
Q  210 caagggcggatccacagtgaaacatggtgtggcagttgccacaccagatt 259  Q
    |||||||||||  | |||||||||||||||||||| ||||||||||||||    
T  5014218 caagggcggatgtagagtgaaacatggtgtggcagctgccacaccagatt 5014169  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #4
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 227 - 256
Target Start/End: Original strand, 13850509 - 13850538
Alignment:
Q  227 tgaaacatggtgtggcagttgccacaccag 256  Q
    ||||||||||||||||||||||||||||||    
T  13850509 tgaaacatggtgtggcagttgccacaccag 13850538  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 50; Significance: 1e-19; HSPs: 12)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 213 - 266
Target Start/End: Complemental strand, 498081 - 498028
Alignment:
Q  213 gggcggatccacagtgaaacatggtgtggcagttgccacaccagattattccct 266  Q
    ||||||||||||| ||||||||||||||||||||||||||||||||||||||||    
T  498081 gggcggatccacactgaaacatggtgtggcagttgccacaccagattattccct 498028  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 213 - 266
Target Start/End: Original strand, 50385860 - 50385913
Alignment:
Q  213 gggcggatccacagtgaaacatggtgtggcagttgccacaccagattattccct 266  Q
    ||||||||||||| ||||||||||||||||||||||||||||||||||||||||    
T  50385860 gggcggatccacactgaaacatggtgtggcagttgccacaccagattattccct 50385913  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 215 - 262
Target Start/End: Complemental strand, 43055652 - 43055605
Alignment:
Q  215 gcggatccacagtgaaacatggtgtggcagttgccacaccagattatt 262  Q
    ||||| |||| |||||||||||||||||||||||||||||||||||||    
T  43055652 gcggacccactgtgaaacatggtgtggcagttgccacaccagattatt 43055605  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 213 - 258
Target Start/End: Original strand, 22418556 - 22418601
Alignment:
Q  213 gggcggatccacagtgaaacatggtgtggcagttgccacaccagat 258  Q
    ||||||||| || |||||||||||||||||||||||||||||||||    
T  22418556 gggcggatctactgtgaaacatggtgtggcagttgccacaccagat 22418601  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #5
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 213 - 265
Target Start/End: Complemental strand, 53446074 - 53446022
Alignment:
Q  213 gggcggatccacagtgaaacatggtgtggcagttgccacaccagattattccc 265  Q
    |||||||| |||  ||||||||||||||||| |||||||||||||||||||||    
T  53446074 gggcggattcaccttgaaacatggtgtggcacttgccacaccagattattccc 53446022  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #6
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 213 - 256
Target Start/End: Complemental strand, 49430676 - 49430633
Alignment:
Q  213 gggcggatccacagtgaaacatggtgtggcagttgccacaccag 256  Q
    ||||||||||||  ||||||||||||||||||||||||||||||    
T  49430676 gggcggatccactttgaaacatggtgtggcagttgccacaccag 49430633  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #7
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 227 - 265
Target Start/End: Complemental strand, 24758640 - 24758602
Alignment:
Q  227 tgaaacatggtgtggcagttgccacaccagattattccc 265  Q
    ||||||||||||||||| |||||||||||||||||||||    
T  24758640 tgaaacatggtgtggcacttgccacaccagattattccc 24758602  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #8
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 227 - 265
Target Start/End: Complemental strand, 24767637 - 24767599
Alignment:
Q  227 tgaaacatggtgtggcagttgccacaccagattattccc 265  Q
    ||||||||||||||||| |||||||||||||||||||||    
T  24767637 tgaaacatggtgtggcacttgccacaccagattattccc 24767599  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #9
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 226 - 259
Target Start/End: Original strand, 2125280 - 2125313
Alignment:
Q  226 gtgaaacatggtgtggcagttgccacaccagatt 259  Q
    ||||||||||||||||||| ||||||||||||||    
T  2125280 gtgaaacatggtgtggcagctgccacaccagatt 2125313  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #10
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 226 - 259
Target Start/End: Original strand, 26555492 - 26555525
Alignment:
Q  226 gtgaaacatggtgtggcagttgccacaccagatt 259  Q
    ||||||||||||||||||| ||||||||||||||    
T  26555492 gtgaaacatggtgtggcagctgccacaccagatt 26555525  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #11
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 226 - 259
Target Start/End: Complemental strand, 28211775 - 28211742
Alignment:
Q  226 gtgaaacatggtgtggcagttgccacaccagatt 259  Q
    ||||||||||||||||||| ||||||||||||||    
T  28211775 gtgaaacatggtgtggcagctgccacaccagatt 28211742  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #12
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 217 - 265
Target Start/End: Complemental strand, 29694358 - 29694310
Alignment:
Q  217 ggatccacagtgaaacatggtgtggcagttgccacaccagattattccc 265  Q
    ||||||||| |||| ||||||||||||  |||||||||| |||||||||    
T  29694358 ggatccacattgaagcatggtgtggcaagtgccacaccaaattattccc 29694310  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 49; Significance: 5e-19; HSPs: 3)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 213 - 265
Target Start/End: Complemental strand, 29247223 - 29247171
Alignment:
Q  213 gggcggatccacagtgaaacatggtgtggcagttgccacaccagattattccc 265  Q
    ||||||||||||| |||||||||||||||||||||||||||||||||||||||    
T  29247223 gggcggatccacactgaaacatggtgtggcagttgccacaccagattattccc 29247171  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 214 - 258
Target Start/End: Complemental strand, 33619691 - 33619647
Alignment:
Q  214 ggcggatccacagtgaaacatggtgtggcagttgccacaccagat 258  Q
    |||||||| || ||||||||||||||||||||||||||| |||||    
T  33619691 ggcggatctactgtgaaacatggtgtggcagttgccacatcagat 33619647  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 226 - 259
Target Start/End: Original strand, 28535209 - 28535242
Alignment:
Q  226 gtgaaacatggtgtggcagttgccacaccagatt 259  Q
    ||||||||||||||||||| ||||||||||||||    
T  28535209 gtgaaacatggtgtggcagctgccacaccagatt 28535242  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 49; Significance: 5e-19; HSPs: 10)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 213 - 265
Target Start/End: Complemental strand, 46913510 - 46913458
Alignment:
Q  213 gggcggatccacagtgaaacatggtgtggcagttgccacaccagattattccc 265  Q
    ||||||||||||| |||||||||||||||||||||||||||||||||||||||    
T  46913510 gggcggatccacactgaaacatggtgtggcagttgccacaccagattattccc 46913458  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 208 - 258
Target Start/End: Original strand, 28998018 - 28998068
Alignment:
Q  208 gtcaagggcggatccacagtgaaacatggtgtggcagttgccacaccagat 258  Q
    |||| ||||||||| || |||||||||||||||||||||||||||||||||    
T  28998018 gtcaggggcggatctactgtgaaacatggtgtggcagttgccacaccagat 28998068  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 213 - 267
Target Start/End: Original strand, 41969780 - 41969834
Alignment:
Q  213 gggcggatccacagtgaaacatggtgtggcagttgccacaccagattattcccta 267  Q
    |||||||| |||  ||||||||||||||||| |||||||||||||||||||||||    
T  41969780 gggcggattcaccttgaaacatggtgtggcacttgccacaccagattattcccta 41969834  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #4
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 213 - 262
Target Start/End: Complemental strand, 42897802 - 42897753
Alignment:
Q  213 gggcggatccacagtgaaacatggtgtggcagttgccacaccagattatt 262  Q
    |||||||||||   |||||||||||||||||||||||| |||||||||||    
T  42897802 gggcggatccagtttgaaacatggtgtggcagttgccataccagattatt 42897753  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #5
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 213 - 248
Target Start/End: Complemental strand, 36617087 - 36617052
Alignment:
Q  213 gggcggatccacagtgaaacatggtgtggcagttgc 248  Q
    ||||||||||||||||||| ||||||||||||||||    
T  36617087 gggcggatccacagtgaaatatggtgtggcagttgc 36617052  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #6
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 232 - 265
Target Start/End: Original strand, 19815130 - 19815163
Alignment:
Q  232 catggtgtggcagttgccacaccagattattccc 265  Q
    |||||||||||| |||||||||||||||||||||    
T  19815130 catggtgtggcacttgccacaccagattattccc 19815163  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #7
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 226 - 259
Target Start/End: Original strand, 38663019 - 38663052
Alignment:
Q  226 gtgaaacatggtgtggcagttgccacaccagatt 259  Q
    ||||||||||||||||||| ||||||||||||||    
T  38663019 gtgaaacatggtgtggcagctgccacaccagatt 38663052  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #8
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 213 - 254
Target Start/End: Complemental strand, 46358056 - 46358015
Alignment:
Q  213 gggcggatccacagtgaaacatggtgtggcagttgccacacc 254  Q
    |||||||||||   ||||||||||||||||||||||||||||    
T  46358056 gggcggatccagtttgaaacatggtgtggcagttgccacacc 46358015  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #9
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 225 - 261
Target Start/End: Original strand, 46437321 - 46437357
Alignment:
Q  225 agtgaaacatggtgtggcagttgccacaccagattat 261  Q
    |||||||||||||||||||| |||||||| |||||||    
T  46437321 agtgaaacatggtgtggcagctgccacacaagattat 46437357  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #10
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 227 - 255
Target Start/End: Complemental strand, 46458026 - 46457998
Alignment:
Q  227 tgaaacatggtgtggcagttgccacacca 255  Q
    |||||||||||||||||||||||||||||    
T  46458026 tgaaacatggtgtggcagttgccacacca 46457998  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 49; Significance: 5e-19; HSPs: 9)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 213 - 265
Target Start/End: Complemental strand, 2123905 - 2123853
Alignment:
Q  213 gggcggatccacagtgaaacatggtgtggcagttgccacaccagattattccc 265  Q
    ||||||||||||| |||||||||||||||||||||||||||||||||||||||    
T  2123905 gggcggatccacactgaaacatggtgtggcagttgccacaccagattattccc 2123853  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 213 - 265
Target Start/End: Original strand, 38740986 - 38741038
Alignment:
Q  213 gggcggatccacagtgaaacatggtgtggcagttgccacaccagattattccc 265  Q
    ||||||||||||| |||||||||||||||||||||||||||||||||||||||    
T  38740986 gggcggatccacactgaaacatggtgtggcagttgccacaccagattattccc 38741038  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 213 - 262
Target Start/End: Original strand, 50158592 - 50158641
Alignment:
Q  213 gggcggatccacagtgaaacatggtgtggcagttgccacaccagattatt 262  Q
    ||||||||||||| ||||||||||||||||||||||||||||||||||||    
T  50158592 gggcggatccacactgaaacatggtgtggcagttgccacaccagattatt 50158641  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 213 - 265
Target Start/End: Original strand, 33403427 - 33403479
Alignment:
Q  213 gggcggatccacagtgaaacatggtgtggcagttgccacaccagattattccc 265  Q
    ||||||||| ||| |||||||||||||||||||||||||||||||||||||||    
T  33403427 gggcggatctacactgaaacatggtgtggcagttgccacaccagattattccc 33403479  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #5
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 227 - 265
Target Start/End: Original strand, 32940712 - 32940750
Alignment:
Q  227 tgaaacatggtgtggcagttgccacaccagattattccc 265  Q
    |||||||||||||||||||||||||||||||||||||||    
T  32940712 tgaaacatggtgtggcagttgccacaccagattattccc 32940750  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #6
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 213 - 258
Target Start/End: Original strand, 37187914 - 37187959
Alignment:
Q  213 gggcggatccacagtgaaacatggtgtggcagttgccacaccagat 258  Q
    ||||||||| || |||||||||||||||||||||||||||||||||    
T  37187914 gggcggatctactgtgaaacatggtgtggcagttgccacaccagat 37187959  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #7
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 225 - 264
Target Start/End: Complemental strand, 5458864 - 5458825
Alignment:
Q  225 agtgaaacatggtgtggcagttgccacaccagattattcc 264  Q
    |||||||||| |||||||||||||||||||||||||||||    
T  5458864 agtgaaacatagtgtggcagttgccacaccagattattcc 5458825  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #8
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 217 - 262
Target Start/End: Original strand, 29702453 - 29702498
Alignment:
Q  217 ggatccacagtgaaacatggtgtggcagttgccacaccagattatt 262  Q
    ||||||| | ||||||||||||||||| ||||||||||||||||||    
T  29702453 ggatccatattgaaacatggtgtggcacttgccacaccagattatt 29702498  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #9
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 225 - 259
Target Start/End: Complemental strand, 18431745 - 18431711
Alignment:
Q  225 agtgaaacatggtgtggcagttgccacaccagatt 259  Q
    |||||||||||||||||||| ||||||||||||||    
T  18431745 agtgaaacatggtgtggcagctgccacaccagatt 18431711  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 48; Significance: 2e-18; HSPs: 8)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 213 - 264
Target Start/End: Original strand, 34225679 - 34225730
Alignment:
Q  213 gggcggatccacagtgaaacatggtgtggcagttgccacaccagattattcc 264  Q
    ||||||||||||| ||||||||||||||||||||||||||||||||||||||    
T  34225679 gggcggatccacactgaaacatggtgtggcagttgccacaccagattattcc 34225730  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 213 - 265
Target Start/End: Original strand, 25981138 - 25981190
Alignment:
Q  213 gggcggatccacagtgaaacatggtgtggcagttgccacaccagattattccc 265  Q
    ||||||||||||| ||||||||||||||||||||||||||||| |||||||||    
T  25981138 gggcggatccacactgaaacatggtgtggcagttgccacaccaaattattccc 25981190  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 219 - 266
Target Start/End: Original strand, 3058969 - 3059016
Alignment:
Q  219 atccacagtgaaacatggtgtggcagttgccacaccagattattccct 266  Q
    ||||||| | ||||||||||||||||||||||||||||||||||||||    
T  3058969 atccacactaaaacatggtgtggcagttgccacaccagattattccct 3059016  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 213 - 265
Target Start/End: Complemental strand, 14396152 - 14396094
Alignment:
Q  213 gggcggatccacagtgaaacatggtgt------ggcagttgccacaccagattattccc 265  Q
    |||||||||||||||||||||||||||      ||||||||||||||||||||||||||    
T  14396152 gggcggatccacagtgaaacatggtgtggcaatggcagttgccacaccagattattccc 14396094  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #5
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 213 - 259
Target Start/End: Complemental strand, 18113880 - 18113834
Alignment:
Q  213 gggcggatccacagtgaaacatggtgtggcagttgccacaccagatt 259  Q
    ||||||||  ||| |||||||||||||||||||||||||||||||||    
T  18113880 gggcggatgtacattgaaacatggtgtggcagttgccacaccagatt 18113834  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #6
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 214 - 262
Target Start/End: Original strand, 2197413 - 2197464
Alignment:
Q  214 ggcggatccacagtgaaacatggtgtggcagtt---gccacaccagattatt 262  Q
    ||||||||||| |||||||||||||||||||||   ||||||||||||||||    
T  2197413 ggcggatccaccgtgaaacatggtgtggcagttgccgccacaccagattatt 2197464  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #7
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 213 - 259
Target Start/End: Complemental strand, 424878 - 424832
Alignment:
Q  213 gggcggatccacagtgaaacatggtgtggcagttgccacaccagatt 259  Q
    ||||||||  ||| |||||||||||||||||| ||||||||||||||    
T  424878 gggcggatgtacattgaaacatggtgtggcagctgccacaccagatt 424832  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #8
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 232 - 265
Target Start/End: Original strand, 39421044 - 39421077
Alignment:
Q  232 catggtgtggcagttgccacaccagattattccc 265  Q
    |||||||||||| |||||||||||||||||||||    
T  39421044 catggtgtggcaattgccacaccagattattccc 39421077  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 46; Significance: 3e-17; HSPs: 5)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 213 - 266
Target Start/End: Complemental strand, 2918004 - 2917951
Alignment:
Q  213 gggcggatccacagtgaaacatggtgtggcagttgccacaccagattattccct 266  Q
    |||||||| |||| ||||||||||||||||||||||||||||||||||||||||    
T  2918004 gggcggattcacactgaaacatggtgtggcagttgccacaccagattattccct 2917951  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 213 - 262
Target Start/End: Complemental strand, 51513177 - 51513128
Alignment:
Q  213 gggcggatccacagtgaaacatggtgtggcagttgccacaccagattatt 262  Q
    |||||||||||| |||||||||||||||||||||||||||| ||||||||    
T  51513177 gggcggatccactgtgaaacatggtgtggcagttgccacactagattatt 51513128  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 213 - 267
Target Start/End: Original strand, 28323076 - 28323130
Alignment:
Q  213 gggcggatccacagtgaaacatggtgtggcagttgccacaccagattattcccta 267  Q
    |||||||| |||  ||||||||||||||||| |||||||||||||||||||||||    
T  28323076 gggcggattcaccttgaaacatggtgtggcacttgccacaccagattattcccta 28323130  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 213 - 267
Target Start/End: Complemental strand, 46672905 - 46672851
Alignment:
Q  213 gggcggatccacagtgaaacatggtgtggcagttgccacaccagattattcccta 267  Q
    |||| |||||||| ||||||||| || |||| |||||||||||||||||| ||||    
T  46672905 gggcagatccacactgaaacatgttgcggcacttgccacaccagattattaccta 46672851  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #5
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 213 - 250
Target Start/End: Original strand, 4939939 - 4939976
Alignment:
Q  213 gggcggatccacagtgaaacatggtgtggcagttgcca 250  Q
    ||||||||||||  ||||||||||||||||||||||||    
T  4939939 gggcggatccactatgaaacatggtgtggcagttgcca 4939976  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 46; Significance: 3e-17; HSPs: 4)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 67 - 120
Target Start/End: Complemental strand, 28654834 - 28654781
Alignment:
Q  67 actctaaaatcaaaaattgggccttgactcagtatattttgatcttaaatattt 120  Q
    |||||||||  |||||||||||||||||||||||||||||||||||||||||||    
T  28654834 actctaaaacgaaaaattgggccttgactcagtatattttgatcttaaatattt 28654781  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 1 - 52
Target Start/End: Complemental strand, 28668244 - 28668193
Alignment:
Q  1 ttggagaaaccatctatgtattttggtggaagagatgctgaacatgatgaac 52  Q
    ||||||||||||||||| ||||||||||||||||||||||||||| ||||||    
T  28668244 ttggagaaaccatctatatattttggtggaagagatgctgaacataatgaac 28668193  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 210 - 262
Target Start/End: Original strand, 37622828 - 37622880
Alignment:
Q  210 caagggcggatccacagtgaaacatggtgtggcagttgccacaccagattatt 262  Q
    |||||||||||||||| |||||||||||||| || ||||||||||||||||||    
T  37622828 caagggcggatccacattgaaacatggtgtgacacttgccacaccagattatt 37622880  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 1 - 44
Target Start/End: Complemental strand, 28676883 - 28676841
Alignment:
Q  1 ttggagaaaccatctatgtattttggtggaagagatgctgaaca 44  Q
    ||||||||||||||||||||||| ||||||||||||||||||||    
T  28676883 ttggagaaaccatctatgtattt-ggtggaagagatgctgaaca 28676841  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University