View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13532_low_4 (Length: 210)

Name: NF13532_low_4
Description: NF13532
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13532_low_4
NF13532_low_4
[»] chr4 (1 HSPs)
chr4 (41-194)||(36836673-36836828)


Alignment Details
Target: chr4 (Bit Score: 145; Significance: 2e-76; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 41 - 194
Target Start/End: Complemental strand, 36836828 - 36836673
Alignment:
Q  41 agaaagcgggaacaggaagaatctttgtggtgtgtgagtgacgagggagtgcgttgtattttattttattaata--aattgttatttttgttgtctgttc 138  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||  ||||||||||||||||||||||||    
T  36836828 agaaagcgggaacaggaagaatctttgtggtgtgtgagtgacgagggagtgcgttgtattttattttattaatattaattgttatttttgttgtctgttc 36836729  T
Q  139 ttgcttgttccttcgctcttgatacttctgagagcgggtacagtgcaggttgtcaa 194  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  36836728 ttgcttgttccttcgctcttgatacttctgagagcgggtacagtgcaggttgtcaa 36836673  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University