View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13529_high_11 (Length: 354)

Name: NF13529_high_11
Description: NF13529
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13529_high_11
NF13529_high_11
[»] chr1 (2 HSPs)
chr1 (30-214)||(44285707-44285890)
chr1 (30-211)||(44070126-44070306)
[»] chr3 (1 HSPs)
chr3 (116-211)||(16443749-16443843)


Alignment Details
Target: chr1 (Bit Score: 125; Significance: 2e-64; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 30 - 214
Target Start/End: Original strand, 44285707 - 44285890
Alignment:
Q  30 cttctcccagtctcggactcagccttttagccgattcgcacctttactctctgtctcaatcgagccggtcagatcaatagagaagtcaggcactcgatag 129  Q
    ||||||||| ||||||||||  ||||||||||||||||||||||||||||||||||||||| |  ||||||||||||||||||||||||||||||||| |    
T  44285707 cttctcccaatctcggactcgaccttttagccgattcgcacctttactctctgtctcaatcaattcggtcagatcaatagagaagtcaggcactcgattg 44285806  T
Q  130 acttaaaggaaggttccgcccgtaaatttcttgatcaatgttaccgggaagcagcaacagagacagattgagtgctaaagcttct 214  Q
    |||||||||||| ||||| |||||||||  |||||||||||||||||||||||||||||||||  |||||||| |||||||||||    
T  44285807 acttaaaggaagattccg-ccgtaaattgattgatcaatgttaccgggaagcagcaacagagatggattgagtactaaagcttct 44285890  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 114; E-Value: 9e-58
Query Start/End: Original strand, 30 - 211
Target Start/End: Complemental strand, 44070306 - 44070126
Alignment:
Q  30 cttctcccagtctcggactcagccttttagccgattcgcacctttactctctgtctcaatcgagccggtcagatcaatagagaagtcaggcactcgatag 129  Q
    ||||||||| |||||||||||||| |||||||| || |||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||| |    
T  44070306 cttctcccaatctcggactcagccgtttagccggtttgcacctttactctctgtctcaatctagccggtcagatcaatagagaagtcaggcacttgattg 44070207  T
Q  130 acttaaaggaaggttccgcccgtaaatttcttgatcaatgttaccgggaagcagcaacagagacagattgagtgctaaagct 211  Q
    |||||||||||||||||| |||| ||||  |||||  ||||| || ||||||||||||||||||||||||||| ||||||||    
T  44070206 acttaaaggaaggttccg-ccgttaattgattgattgatgttgccaggaagcagcaacagagacagattgagtactaaagct 44070126  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 48; Significance: 2e-18; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 116 - 211
Target Start/End: Complemental strand, 16443843 - 16443749
Alignment:
Q  116 caggcactcgatagacttaaaggaaggttccgcccgtaaatttcttgatcaatgttaccgggaagcagcaacagagacagattgagtgctaaagct 211  Q
    |||||||| ||| ||||||||||||||||||||| || ||||  |||||  ||||| || ||||||||||||||||||||||||||| ||||||||    
T  16443843 caggcacttgattgacttaaaggaaggttccgcc-gttaattgattgattgatgttgccaggaagcagcaacagagacagattgagtactaaagct 16443749  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University