View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1351_low_58 (Length: 251)

Name: NF1351_low_58
Description: NF1351
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1351_low_58
NF1351_low_58
[»] chr4 (2 HSPs)
chr4 (135-251)||(53458943-53459059)
chr4 (30-142)||(53458793-53458905)


Alignment Details
Target: chr4 (Bit Score: 113; Significance: 3e-57; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 113; E-Value: 3e-57
Query Start/End: Original strand, 135 - 251
Target Start/End: Original strand, 53458943 - 53459059
Alignment:
Q  135 ttgctatgcaaatgtgtgcagtcaaaaataattttcttactattagtgtattgcatattatattattactttacatatgtttgttgcaaaaataggaaat 234  Q
    |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  53458943 ttgctatgcaaaggtgtgcagtcaaaaataattttcttactattagtgtattgcatattatattattactttacatatgtttgttgcaaaaataggaaat 53459042  T
Q  235 gtaagagaattatgaac 251  Q
    |||||||||||||||||    
T  53459043 gtaagagaattatgaac 53459059  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 105; E-Value: 1e-52
Query Start/End: Original strand, 30 - 142
Target Start/End: Original strand, 53458793 - 53458905
Alignment:
Q  30 tttgttgtaagatcaaatggttcaaagatcagcgaggatgaaatcaagcaatacatatcacaacaggttctctttaatctttaccaaattagtagattaa 129  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||    
T  53458793 tttgttgtaagatcaaatggttcaaagatcagcgaggatgaaatcaagcaatacatatcgcaacaggttctctttaatctttaccaaattagtagattaa 53458892  T
Q  130 ttttcttgctatg 142  Q
    |||||||| ||||    
T  53458893 ttttcttgttatg 53458905  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University