View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1351_low_36 (Length: 288)

Name: NF1351_low_36
Description: NF1351
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1351_low_36
NF1351_low_36
[»] chr8 (1 HSPs)
chr8 (67-241)||(35059943-35060117)


Alignment Details
Target: chr8 (Bit Score: 167; Significance: 2e-89; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 167; E-Value: 2e-89
Query Start/End: Original strand, 67 - 241
Target Start/End: Original strand, 35059943 - 35060117
Alignment:
Q  67 taatcctcctcaatccatccataaccaccatctccaacctctccataacccccttctccgatggctacgacgacggtttcatcgccatcacaaacaccga 166  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||    
T  35059943 taatcctcctcaatccatccataaccaccatctccaacctctccataacccccttctccgatggctacaacgacggtttcatcgccatcacaaacaccga 35060042  T
Q  167 cgctgatttccaccaatacacctcacagttcaacacccgtggctccgacttcatcaccaatctcatactctctgc 241  Q
    |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  35060043 cgctgatttccatcaatacacctcacagttcaacacccgtggctccgacttcatcaccaatctcatactctctgc 35060117  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University