View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1351_low_35 (Length: 306)

Name: NF1351_low_35
Description: NF1351
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1351_low_35
NF1351_low_35
[»] chr4 (1 HSPs)
chr4 (23-253)||(20823134-20823365)


Alignment Details
Target: chr4 (Bit Score: 171; Significance: 8e-92; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 171; E-Value: 8e-92
Query Start/End: Original strand, 23 - 253
Target Start/End: Original strand, 20823134 - 20823365
Alignment:
Q  23 cttttttgtaacggatattgatatataatgttagttttacgttggaggtgaggatcaaactcttatcacaccgcgtatttactactccacccttgccact 122  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||    
T  20823134 cttttttgtaacggatattgatatataatgttagttttacgttggaggtgaggatcaaactcttatcacaccacgtatttactactccacccttgccact 20823233  T
Q  123 taaccaaccgattatcaatctatctaaatacaactacatgatgacgacaaactatgaagagaaacgaactaa-annnnnnncagaagtaaaacaaaatct 221  Q
    |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||         |||||||||||||||||||    
T  20823234 taaccaaccgattatcaatctatctaaatacaactacatgatgacggcaaactatgaagataaacgaactaattttttttccagaagtaaaacaaaatct 20823333  T
Q  222 tacaccatccgtctatagttataagactattt 253  Q
    ||| |||||||||| || |||||||| |||||    
T  20823334 tactccatccgtctctaattataagattattt 20823365  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University