View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13518_low_19 (Length: 226)

Name: NF13518_low_19
Description: NF13518
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13518_low_19
NF13518_low_19
[»] chr6 (1 HSPs)
chr6 (107-208)||(31026300-31026403)


Alignment Details
Target: chr6 (Bit Score: 81; Significance: 3e-38; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 107 - 208
Target Start/End: Complemental strand, 31026403 - 31026300
Alignment:
Q  107 ctcacatcttatattactttggcatatttaaaatatcat--gtgaggtttcagtgttaaaactaattaaaccatcatctaaattgtaagtttataattgg 204  Q
    |||||||||||||||||||| ||||||||||||||||||  ||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||    
T  31026403 ctcacatcttatattactttcgcatatttaaaatatcatatgtgaggttttagtgttaaaactaattaaagcatcatctaaattgtaagtttataattgg 31026304  T
Q  205 cagt 208  Q
    ||||    
T  31026303 cagt 31026300  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University