View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13495_low_30 (Length: 203)

Name: NF13495_low_30
Description: NF13495
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13495_low_30
NF13495_low_30
[»] chr3 (1 HSPs)
chr3 (12-184)||(36724343-36724515)
[»] chr8 (1 HSPs)
chr8 (80-179)||(42172969-42173068)


Alignment Details
Target: chr3 (Bit Score: 145; Significance: 2e-76; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 12 - 184
Target Start/End: Original strand, 36724343 - 36724515
Alignment:
Q  12 gaagaaaatcaataacaataacaacatcaataagaagcatggagataacactgatgttgcaaaaacttctgctgacaagaaatttaaaactctgccacca 111  Q
    |||||| ||||| ||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||     
T  36724343 gaagaatatcaacaacaataacaacatcaacaagaaacatggagataacactgatgttgcaaaaacttctgctgacaagaaattcaaaactctgccaccg 36724442  T
Q  112 tctgagtccttacctaggaatgaaaccattggtggctatatatttgtttgcaacaatgataccatggcagaaa 184  Q
    ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||    
T  36724443 tctgagtccttacctaggaatgaaaccattggtggctatatctttgtttgcaacaatgataccatggcagaaa 36724515  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 44; Significance: 3e-16; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 80 - 179
Target Start/End: Complemental strand, 42173068 - 42172969
Alignment:
Q  80 ctgctgacaagaaatttaaaactctgccaccatctgagtccttacctaggaatgaaaccattggtggctatatatttgtttgcaacaatgataccatggc 179  Q
    |||||||||||| ||| || ||| | |||||| | |||||  | ||||||||||||||||||||||| ||||| ||||| || |||||||||||||||||    
T  42173068 ctgctgacaagagattcaagactttaccaccagcagagtctcttcctaggaatgaaaccattggtgggtatatctttgtctgtaacaatgataccatggc 42172969  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University