View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13494_low_6 (Length: 246)

Name: NF13494_low_6
Description: NF13494
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13494_low_6
NF13494_low_6
[»] chr5 (1 HSPs)
chr5 (1-240)||(2946641-2946880)


Alignment Details
Target: chr5 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 1 - 240
Target Start/End: Complemental strand, 2946880 - 2946641
Alignment:
Q  1 cttttggtggaggcatgagagtttgtgttgggacagaatttgctaaggttcagatggcagtttttcttcattgcttggtaacaaagtataggtaataagc 100  Q
    |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  2946880 cttttggtggaggcatgagattttgtgttgggacagaatttgctaaggttcagatggcagtttttcttcattgcttggtaacaaagtataggtaataagc 2946781  T
Q  101 aatgtcatgcatggaaagagactttaaactgaaacaatgtaccttctttaacgcttgaatttaatttagaatgcggagtagtctctttaacgtctgaata 200  Q
    ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  2946780 aatgtcatgcatggaaagagactttaaactgaaacaacgtaccttctttaacgcttgaatttaatttagaatgcggagtagtctctttaacgtctgaata 2946681  T
Q  201 tttcaggtggcgacccatcaaaggagggaatattcttcga 240  Q
    |||||||||||||||||||||||||||||||||| |||||    
T  2946680 tttcaggtggcgacccatcaaaggagggaatattgttcga 2946641  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University