View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1348_high_65 (Length: 272)

Name: NF1348_high_65
Description: NF1348
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1348_high_65
NF1348_high_65
[»] chr3 (1 HSPs)
chr3 (117-241)||(32069653-32069778)


Alignment Details
Target: chr3 (Bit Score: 85; Significance: 1e-40; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 117 - 241
Target Start/End: Complemental strand, 32069778 - 32069653
Alignment:
Q  117 caacaacaacagaaatactcaatctctgtcgtgnnnnnnn-gccaaaataatatgagaaagtggaaattcagtctctttctatggcttgcatcgttttgt 215  Q
    ||||||||||| |||||||||||||||||||||        |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  32069778 caacaacaacaaaaatactcaatctctgtcgtgttttttttgccaaaataatatgagaaagtggaaattcagtctctttctatggcttgcatcgttttgt 32069679  T
Q  216 tttttgttacagtgttttggtctgtg 241  Q
    ||||||| ||||||||||||| ||||    
T  32069678 tttttgtcacagtgttttggtttgtg 32069653  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University