View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13487_high_2 (Length: 206)

Name: NF13487_high_2
Description: NF13487
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13487_high_2
NF13487_high_2
[»] chr1 (1 HSPs)
chr1 (20-159)||(42236141-42236280)


Alignment Details
Target: chr1 (Bit Score: 136; Significance: 4e-71; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 136; E-Value: 4e-71
Query Start/End: Original strand, 20 - 159
Target Start/End: Complemental strand, 42236280 - 42236141
Alignment:
Q  20 ctatttgggtcttgtgatgaggatgatggagttgaggttgatgttgaagtgtttcttagtctacgttcatcgtctagtttcttggctgtgatgagaataa 119  Q
    |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  42236280 ctatttgggtcttgtgatgatgatgatggagttgaggttgatgttgaagtgtttcttagtctacgttcatcgtctagtttcttggctgtgatgagaataa 42236181  T
Q  120 gtgtttcttggattgtccaattacctttacggtattctct 159  Q
    ||||||||||||||||||||||||||||||||||||||||    
T  42236180 gtgtttcttggattgtccaattacctttacggtattctct 42236141  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University