View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13483_high_2 (Length: 288)

Name: NF13483_high_2
Description: NF13483
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13483_high_2
NF13483_high_2
[»] chr5 (1 HSPs)
chr5 (22-275)||(14180721-14180975)


Alignment Details
Target: chr5 (Bit Score: 211; Significance: 1e-115; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 211; E-Value: 1e-115
Query Start/End: Original strand, 22 - 275
Target Start/End: Original strand, 14180721 - 14180975
Alignment:
Q  22 ccgcaccgacatatgtggt-acatacattcaataattccatgttctgaaannnnnnnnggttggtatcgatgtatcaatgtcagtgatgtgtgcagtatt 120  Q
    ||||||||||||||||||| ||||||||||||||||||||||||||||||        ||||||||||||||||||||||||||||||||||||||||||    
T  14180721 ccgcaccgacatatgtggttacatacattcaataattccatgttctgaaattattattggttggtatcgatgtatcaatgtcagtgatgtgtgcagtatt 14180820  T
Q  121 cgtgtatgtgtcagtatttcatagatcacagatgttgctccatccatgtgtctctaggagcttttctaacgccgaaatactctacaacgctttcagaaac 220  Q
    |||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  14180821 cgtgtatgtgtcggtatttcatagatcacagctgttgctccatccatgtgtctctaggagcttttctaacgccgaaatactctacaacgctttcagaaac 14180920  T
Q  221 cccagcaacattactcaataatgaggctccccatgccagccaacctgtctgtgct 275  Q
    |||||||||||||||||||||||||| ||||||||||||||||||||||||||||    
T  14180921 cccagcaacattactcaataatgaggttccccatgccagccaacctgtctgtgct 14180975  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University