View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13471_high_1 (Length: 369)

Name: NF13471_high_1
Description: NF13471
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13471_high_1
NF13471_high_1
[»] chr3 (1 HSPs)
chr3 (54-363)||(32006193-32006501)


Alignment Details
Target: chr3 (Bit Score: 236; Significance: 1e-130; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 54 - 363
Target Start/End: Complemental strand, 32006501 - 32006193
Alignment:
Q  54 cttttgttgcttcttcttaaaaggaaagaagctgcattttaatcggagaagcttcagttttaatttcgtcgagattccctttcttgtccagtggtaagct 153  Q
    |||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| || ||||| ||||||    
T  32006501 cttttgctgcttcttcttcaaaggaaagaagctgcattttaatcggagaagcttcagttttaatttcgtcgagattcactttctcgttcagtgataagct 32006402  T
Q  154 ccatggcatcccatttcttgtccagattcactttcaatcaggctttcggtcttggccgtcgcccttgttgtatttgtcgtgcgaaacagttgcagtatca 253  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||    
T  32006401 ccatggcatcccatttcttgtccagattcactttcaatcaggctttcggtcttggccatcgcccttgttgtatttgtcgtgcgaaacagttgcagtatca 32006302  T
Q  254 taaaacgattgagttcttcggtggtgttctcgccatcccgccgtcgatgatattgaatggagannnnnnnccgattttgctctcctctctcttattccga 353  Q
    ||||| ||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||       ||||||||||||||||||||||||||||||    
T  32006301 taaaatgattgagttcttcggcggtgttctcgccatcccgccgtcaatgatattgaatggaga-ttttttccgattttgctctcctctctcttattccga 32006203  T
Q  354 ttttcttcga 363  Q
    | || |||||    
T  32006202 tcttgttcga 32006193  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University