View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13469_high_23 (Length: 329)

Name: NF13469_high_23
Description: NF13469
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13469_high_23
NF13469_high_23
[»] chr1 (2 HSPs)
chr1 (177-321)||(49096545-49096689)
chr1 (5-51)||(49096393-49096436)


Alignment Details
Target: chr1 (Bit Score: 141; Significance: 7e-74; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 141; E-Value: 7e-74
Query Start/End: Original strand, 177 - 321
Target Start/End: Original strand, 49096545 - 49096689
Alignment:
Q  177 attaaggaagagtatagtcaatggaatattattggaatagtatattgatgattgaatgtgcatgatattgtaatttatgcaatgaaatgaaattagcatg 276  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||    
T  49096545 attaaggaagagtatagtcaatggaatattattggaatagtatattgattattgaatgtgcatgatattgtaatttatgcaatgaaatgaaattagcatg 49096644  T
Q  277 tgcgtgtgtcagattgagatttgttgaccggtgtgtgtctgtgct 321  Q
    |||||||||||||||||||||||||||||||||||||||||||||    
T  49096645 tgcgtgtgtcagattgagatttgttgaccggtgtgtgtctgtgct 49096689  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 5 - 51
Target Start/End: Original strand, 49096393 - 49096436
Alignment:
Q  5 cccatcacgatcaataaaatttattactaacttgtaatttgattgag 51  Q
    |||||||||||||||||||||||||||   |||||||||||||||||    
T  49096393 cccatcacgatcaataaaatttattac---cttgtaatttgattgag 49096436  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University