View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1345_low_162 (Length: 331)

Name: NF1345_low_162
Description: NF1345
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1345_low_162
NF1345_low_162
[»] chr8 (1 HSPs)
chr8 (97-272)||(40205827-40206002)


Alignment Details
Target: chr8 (Bit Score: 172; Significance: 2e-92; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 172; E-Value: 2e-92
Query Start/End: Original strand, 97 - 272
Target Start/End: Complemental strand, 40206002 - 40205827
Alignment:
Q  97 gatcatccagggtcctacaaatatactatagaggatggaggctgcaaaattgaacgttggcatagatgggaagtcccatccatgatcagcacatcacatc 196  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  40206002 gatcatccagggtcctacaaatatactatagaggatggaggctgcaaaattgaacgttggcatagatgggaagtcccatccatgatcagcacatcacatc 40205903  T
Q  197 ctgaaattaataagatagttgctatacaacatgacccaataaaaccaaccccaccagcttcagcccccttcatctc 272  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||    
T  40205902 ctgaaattaataagatagttgctatacaacatgacccaataaaaccaaccccaccagcttcagcccccttcttctc 40205827  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University