View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13456_low_4 (Length: 251)

Name: NF13456_low_4
Description: NF13456
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13456_low_4
NF13456_low_4
[»] chr6 (2 HSPs)
chr6 (17-132)||(9083111-9083226)
chr6 (196-251)||(9082993-9083048)


Alignment Details
Target: chr6 (Bit Score: 88; Significance: 2e-42; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 17 - 132
Target Start/End: Complemental strand, 9083226 - 9083111
Alignment:
Q  17 ataaaaataaatcaaacttaataccaaaaatttaccctttagatacattcaataaatgacgatattagatagaccacatatatcatttattaaagagaaa 116  Q
    |||||||||||||||||||||||  |||| |||||||||||||||||||||||||||||||||||||  |||||||||||||||||||||||||||||||    
T  9083226 ataaaaataaatcaaacttaatataaaaattttaccctttagatacattcaataaatgacgatattatgtagaccacatatatcatttattaaagagaaa 9083127  T
Q  117 tgatatatgtacaact 132  Q
    |||||| |||| ||||    
T  9083126 tgatatttgtataact 9083111  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 196 - 251
Target Start/End: Complemental strand, 9083048 - 9082993
Alignment:
Q  196 ctctattactttaatttttatgtcaaagcacacttctctgtaaaactgtggttgtc 251  Q
    |||| |||||||  ||||||||||||||||||||||| ||||||| ||||||||||    
T  9083048 ctctgttactttggtttttatgtcaaagcacacttctgtgtaaaaatgtggttgtc 9082993  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University