View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1344_low_9 (Length: 337)

Name: NF1344_low_9
Description: NF1344
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1344_low_9
NF1344_low_9
[»] chr2 (2 HSPs)
chr2 (181-329)||(38150938-38151086)
chr2 (121-182)||(38150831-38150892)


Alignment Details
Target: chr2 (Bit Score: 133; Significance: 4e-69; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 133; E-Value: 4e-69
Query Start/End: Original strand, 181 - 329
Target Start/End: Original strand, 38150938 - 38151086
Alignment:
Q  181 aatatacctgattaacctatataaaaataaaataaaactttctctcacctctctactgtcatacagtactggattcatgcaaatagcaacttctctacgc 280  Q
    |||||| |||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  38150938 aatatagctgattaaccaaaataaaaataaaataaaactttctctcacctctctactgtcatacagtactggattcatgcaaatagcaacttctctacgc 38151037  T
Q  281 ctttaaccactcttcacttcacagtcacttcatttgttcccttcatctc 329  Q
    |||||||||||||||||||||||||||||||||||||||||||| ||||    
T  38151038 ctttaaccactcttcacttcacagtcacttcatttgttcccttcgtctc 38151086  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 54; E-Value: 6e-22
Query Start/End: Original strand, 121 - 182
Target Start/End: Original strand, 38150831 - 38150892
Alignment:
Q  121 gtgcacaattttaatactatttcagtgagaactctatcaaatctaattattcttataaacaa 182  Q
    ||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||    
T  38150831 gtgcaaaattttaatactattacagtgagaactctatcaaatctaattattcttataaacaa 38150892  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University