View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1343_low_46 (Length: 543)

Name: NF1343_low_46
Description: NF1343
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1343_low_46
NF1343_low_46
[»] chr5 (2 HSPs)
chr5 (497-543)||(26127670-26127716)
chr5 (498-537)||(26125916-26125955)
[»] chr3 (1 HSPs)
chr3 (6-38)||(31581832-31581864)


Alignment Details
Target: chr5 (Bit Score: 47; Significance: 1e-17; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 497 - 543
Target Start/End: Complemental strand, 26127716 - 26127670
Alignment:
Q  497 aataactttattaagaattttccaagatagtcatcatcttttcgaaa 543  Q
    |||||||||||||||||||||||||||||||||||||||||||||||    
T  26127716 aataactttattaagaattttccaagatagtcatcatcttttcgaaa 26127670  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 498 - 537
Target Start/End: Complemental strand, 26125955 - 26125916
Alignment:
Q  498 ataactttattaagaattttccaagatagtcatcatcttt 537  Q
    ||||||| |||||||||||||||||||||| |||||||||    
T  26125955 ataacttcattaagaattttccaagatagttatcatcttt 26125916  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 33; Significance: 0.000000003; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 6 - 38
Target Start/End: Original strand, 31581832 - 31581864
Alignment:
Q  6 aaaatatccattggatttgaatgcaacagctag 38  Q
    |||||||||||||||||||||||||||||||||    
T  31581832 aaaatatccattggatttgaatgcaacagctag 31581864  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University