View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1343_low_184 (Length: 235)

Name: NF1343_low_184
Description: NF1343
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1343_low_184
NF1343_low_184
[»] chr3 (1 HSPs)
chr3 (96-225)||(10379060-10379189)


Alignment Details
Target: chr3 (Bit Score: 130; Significance: 2e-67; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 96 - 225
Target Start/End: Original strand, 10379060 - 10379189
Alignment:
Q  96 gtttggtgctctcatacaacccttttctgatttagattatcatgttaacatgatacatgcacttgatctctgttgtgtcaatggcatagtatagatgctg 195  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  10379060 gtttggtgctctcatacaacccttttctgatttagattatcatgttaacatgatacatgcacttgatctctgttgtgtcaatggcatagtatagatgctg 10379159  T
Q  196 acattctcaaaggaaggtccatgttctctg 225  Q
    ||||||||||||||||||||||||||||||    
T  10379160 acattctcaaaggaaggtccatgttctctg 10379189  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University