View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13436_high_12 (Length: 265)

Name: NF13436_high_12
Description: NF13436
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13436_high_12
NF13436_high_12
[»] chr2 (1 HSPs)
chr2 (12-247)||(31910455-31910689)


Alignment Details
Target: chr2 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 12 - 247
Target Start/End: Original strand, 31910455 - 31910689
Alignment:
Q  12 atgaaatacgaaaacaacttttatctcattttgtaacacaatttagactataaatagtcagttaattgcaaccaaaattgtgagaaaactgaagggaatt 111  Q
    ||||||||||| |||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||    
T  31910455 atgaaatacgagaacaacttttatctcattttataacacaatttagactatcaatagtcagttaattgcaaccaaaattgtgagaaaactgaagggaatt 31910554  T
Q  112 aagtcttcttctcaaagtaaccaaaatcacttaaaaatgacatgtatattaaaagttatacggaaaatactatcaagatgtccaaaatacgagttgaaat 211  Q
    ||||||||||||||| ||||| ||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||| |||||||||||| ||| |||    
T  31910555 aagtcttcttctcaatgtaactaaaatcacttaaaaatggcatgtatattaaaagttatacgg-aaatactatcaagatatccaaaatacgatttgcaat 31910653  T
Q  212 attttatataaatcaataaatttagcatggtctttg 247  Q
    ||||||||||||||||||||||||||||| ||||||    
T  31910654 attttatataaatcaataaatttagcatgatctttg 31910689  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University