View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13433_low_7 (Length: 243)

Name: NF13433_low_7
Description: NF13433
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13433_low_7
NF13433_low_7
[»] chr2 (1 HSPs)
chr2 (19-218)||(8587668-8587870)


Alignment Details
Target: chr2 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 19 - 218
Target Start/End: Complemental strand, 8587870 - 8587668
Alignment:
Q  19 caatcttctgcgtcgtcgttttagttaccttagctcttttcacacttaactccaattctacctctacaattcgaa---tttccaacgtcgtttttgatgg 115  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||   ||||||||||||||||||||||    
T  8587870 caatcttctgcgtcgtcgttttagttaccttagctcttttcacacttaactccaattctagctctacaattcgaagaatttccaacgtcgtttttgatgg 8587771  T
Q  116 tcctccaaaaatcgcttttttattcctcgttcgtcaaaatattccccttgattttctctggggtgctttctttcaggttccttcaatttcctctgcctct 215  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  8587770 tcctccaaaaatcgcttttttattcctcgttcgtcaaaatattccccttgattttctctggggtgctttctttcaggttccttcaatttcctctgcctct 8587671  T
Q  216 ttt 218  Q
    |||    
T  8587670 ttt 8587668  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University