View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1342_low_91 (Length: 211)

Name: NF1342_low_91
Description: NF1342
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1342_low_91
NF1342_low_91
[»] chr2 (3 HSPs)
chr2 (1-133)||(40093926-40094058)
chr2 (1-133)||(40063295-40063426)
chr2 (1-133)||(40081646-40081776)


Alignment Details
Target: chr2 (Bit Score: 97; Significance: 7e-48; HSPs: 3)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 97; E-Value: 7e-48
Query Start/End: Original strand, 1 - 133
Target Start/End: Complemental strand, 40094058 - 40093926
Alignment:
Q  1 gtttcaaaaacgactgtggcacgtggtatctgtgagatgggattaatgtcgcagtcacatcatagatcaagannnnnnnnctcatgtttaaactcttctt 100  Q
    ||||||||||||||||||||||||||||||||||||||| |||||||||| || ||||||||||||||||||        ||||||||||||||||||||    
T  40094058 gtttcaaaaacgactgtggcacgtggtatctgtgagatgagattaatgtctcaatcacatcatagatcaagattttttttctcatgtttaaactcttctt 40093959  T
Q  101 cattgaaaatttgcaacacttacaatgtctgtg 133  Q
    |||||||||||||||||||||||||||||||||    
T  40093958 cattgaaaatttgcaacacttacaatgtctgtg 40093926  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 1 - 133
Target Start/End: Complemental strand, 40063426 - 40063295
Alignment:
Q  1 gtttcaaaaacgactgtggcacgtggtatctgtgagatgggattaatgtcgcagtcacatcatagatcaagannnnnnnnctcatgtttaaactcttctt 100  Q
    |||||||||||||  |||| || ||||||||| ||||||||||||||||| |||||||||| ||||||||||         |||||||||||||||| ||    
T  40063426 gtttcaaaaacgatcgtggtacatggtatctgcgagatgggattaatgtctcagtcacatcgtagatcaagatttttttt-tcatgtttaaactcttttt 40063328  T
Q  101 cattgaaaatttgcaacacttacaatgtctgtg 133  Q
    |||||||||||||||||||||||||||||||||    
T  40063327 cattgaaaatttgcaacacttacaatgtctgtg 40063295  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 1 - 133
Target Start/End: Complemental strand, 40081776 - 40081646
Alignment:
Q  1 gtttcaaaaacgactgtggcacgtggtatctgtgagatgggattaatgtcgcagtcacatcatagatcaagannnnnnnnctcatgtttaaactcttctt 100  Q
    |||||||||||||  |||| || |||||||||  ||||| ||||| |||| |||| ||||||||||||||||         |  |||||||||| || ||    
T  40081776 gtttcaaaaacgatcgtggtacatggtatctgcaagatgcgattattgtctcagtaacatcatagatcaagattattttctt--tgtttaaacttttttt 40081679  T
Q  101 cattgaaaatttgcaacacttacaatgtctgtg 133  Q
     ||||||||||||||||||||||||||||||||    
T  40081678 tattgaaaatttgcaacacttacaatgtctgtg 40081646  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University