View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1342_high_73 (Length: 216)

Name: NF1342_high_73
Description: NF1342
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1342_high_73
NF1342_high_73
[»] chr1 (1 HSPs)
chr1 (82-206)||(11402851-11402976)


Alignment Details
Target: chr1 (Bit Score: 118; Significance: 2e-60; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 118; E-Value: 2e-60
Query Start/End: Original strand, 82 - 206
Target Start/End: Original strand, 11402851 - 11402976
Alignment:
Q  82 gtggaattttcaagtctttgtcatgaccgcaaa-tggtctcaaatgatttttccaaatcatgacctctttatctccttttttgaggaaatgacctcttat 180  Q
    ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  11402851 gtggaattttcaagtctttgtcatgaccgcaaaatggtctcaaatgatttttccaaatcatgacctctttatctccttttttgaggaaatgacctcttat 11402950  T
Q  181 ctcatactcatatggtgtgttctctg 206  Q
    ||||||||||||||||||||||||||    
T  11402951 ctcatactcatatggtgtgttctctg 11402976  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University