View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1342_high_42 (Length: 305)

Name: NF1342_high_42
Description: NF1342
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1342_high_42
NF1342_high_42
[»] chr7 (2 HSPs)
chr7 (78-303)||(29922578-29922803)
chr7 (201-247)||(29880678-29880724)
[»] chr3 (1 HSPs)
chr3 (204-247)||(3625181-3625224)


Alignment Details
Target: chr7 (Bit Score: 222; Significance: 1e-122; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 78 - 303
Target Start/End: Complemental strand, 29922803 - 29922578
Alignment:
Q  78 atctgagagggattacaatctcgttccataccctataagtcgtttactagataacccgtcattcacccttcttttagatgatccttacaatagtgtcact 177  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  29922803 atctgagagggattacaatctcgttccataccctataagtcgtttactagataacccgtcattcacccttcttttagatgatccttacaatagtgtcact 29922704  T
Q  178 tactatcatgtcaacaacgacatatgctctcgtataattggttcatgcaatggattgatctgtttggctgagacttctttaacccatgatgggtatcaag 277  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||    
T  29922703 tactatcatgtcaacaacgacatatgctctcgtataattggttcatgcaatggattgatttgtttggctgagacttctttaacccatgatgggtatcaag 29922604  T
Q  278 agaattggcgtagagagtattggttc 303  Q
    ||||||||||||||||||||||||||    
T  29922603 agaattggcgtagagagtattggttc 29922578  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 201 - 247
Target Start/End: Original strand, 29880678 - 29880724
Alignment:
Q  201 atgctctcgtataattggttcatgcaatggattgatctgtttggctg 247  Q
    ||||||||||||| ||||| | |||||||| ||||||||||||||||    
T  29880678 atgctctcgtatagttggtacctgcaatggtttgatctgtttggctg 29880724  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 32; Significance: 0.000000007; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 204 - 247
Target Start/End: Original strand, 3625181 - 3625224
Alignment:
Q  204 ctctcgtataattggttcatgcaatggattgatctgtttggctg 247  Q
    |||||||||| ||||||| |||||||||||||| ||||||||||    
T  3625181 ctctcgtatagttggttcctgcaatggattgatatgtttggctg 3625224  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University