View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1341_low_26 (Length: 237)

Name: NF1341_low_26
Description: NF1341
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1341_low_26
NF1341_low_26
[»] chr4 (1 HSPs)
chr4 (100-165)||(53834737-53834802)


Alignment Details
Target: chr4 (Bit Score: 58; Significance: 2e-24; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 100 - 165
Target Start/End: Original strand, 53834737 - 53834802
Alignment:
Q  100 tggacaagacatgcccataaccacattggggcagcgatgatctaaccttgttaaatattattcgac 165  Q
    |||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||    
T  53834737 tggacaagacatgcccataaccacattgggacagcgatgatctaaccttgttaaataatattcgac 53834802  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University