View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13407_high_2 (Length: 464)

Name: NF13407_high_2
Description: NF13407
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13407_high_2
NF13407_high_2
[»] chr2 (3 HSPs)
chr2 (246-418)||(14431097-14431269)
chr2 (140-246)||(14430946-14431052)
chr2 (123-164)||(14430734-14430775)


Alignment Details
Target: chr2 (Bit Score: 137; Significance: 2e-71; HSPs: 3)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 137; E-Value: 2e-71
Query Start/End: Original strand, 246 - 418
Target Start/End: Original strand, 14431097 - 14431269
Alignment:
Q  246 gttttcgtccccagagctttgactttttcgccgaatttgtaagagaggtttaagttccctttagctttccccgaagacgttctaacctgataattaacca 345  Q
    |||||| || || |||||| |||||||||||||||||||||||||||||||||||| |||||||||||||| ||||| |||||||||||||||||||||     
T  14431097 gttttcatcgccggagcttggactttttcgccgaatttgtaagagaggtttaagtttcctttagctttccctgaagatgttctaacctgataattaacct 14431196  T
Q  346 gccggaaagaatctccggaggtgttatcaagaagctccttgagagggatatgaaccttgccgatcaaggtatc 418  Q
    ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||    
T  14431197 gccggaaagaatctccggaggggttatcaagaagctccttgagagggatatgaaccttgccgatcaaggtatc 14431269  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 95; E-Value: 3e-46
Query Start/End: Original strand, 140 - 246
Target Start/End: Original strand, 14430946 - 14431052
Alignment:
Q  140 tggatatccataaaccggttgttgcagctgaggaggataaggtgtaccatacggcaccgagctagaccccgctgccgccattccaggtggaggataagcc 239  Q
    ||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||    
T  14430946 tggatatccataacccggttgttgcggctgaggaggataaggtgtaccatacggcaccgagctagacccagctgccgccattccaggtggaggataagcc 14431045  T
Q  240 atcaccg 246  Q
    |||||||    
T  14431046 atcaccg 14431052  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 123 - 164
Target Start/End: Original strand, 14430734 - 14430775
Alignment:
Q  123 ttctgtgcttctgccactggatatccataaaccggttgttgc 164  Q
    |||||||||| |||| |||||||||||||| |||||||||||    
T  14430734 ttctgtgcttgtgcccctggatatccataacccggttgttgc 14430775  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University