View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13405_high_2 (Length: 442)

Name: NF13405_high_2
Description: NF13405
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13405_high_2
NF13405_high_2
[»] chr1 (10 HSPs)
chr1 (1-340)||(23896703-23897042)
chr1 (170-303)||(25611722-25611855)
chr1 (138-307)||(24512229-24512401)
chr1 (170-278)||(24234114-24234222)
chr1 (202-294)||(24635570-24635662)
chr1 (202-311)||(24247301-24247410)
chr1 (194-279)||(25869445-25869530)
chr1 (358-414)||(23897129-23897185)
chr1 (202-298)||(51831606-51831702)
chr1 (202-271)||(45693643-45693712)
[»] scaffold0015 (1 HSPs)
scaffold0015 (194-295)||(41133-41234)
[»] chr7 (1 HSPs)
chr7 (170-300)||(1421900-1422030)
[»] scaffold1004 (1 HSPs)
scaffold1004 (220-278)||(1397-1455)
[»] chr3 (2 HSPs)
chr3 (208-275)||(1941334-1941401)
chr3 (194-298)||(43991242-43991346)
[»] scaffold0760 (1 HSPs)
scaffold0760 (220-278)||(3891-3949)


Alignment Details
Target: chr1 (Bit Score: 296; Significance: 1e-166; HSPs: 10)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 296; E-Value: 1e-166
Query Start/End: Original strand, 1 - 340
Target Start/End: Original strand, 23896703 - 23897042
Alignment:
Q  1 caagaagcaatgaggtgatccatacaatctgtattaatgggagagtaatcgagttgtgtggcagtttcagatgtgaaaatagagtcaattgagtaagaca 100  Q
    ||||||||||||||  ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  23896703 caagaagcaatgagtcgatccatacaatctgtattaatgggagagtaatcgagttgtgtggcagtttcagatgtgaaaatagagtcaattgagtaagaca 23896802  T
Q  101 ttacagataactcttttcttgacgagtgcaatgagcttgtgacgaggtgtttgcgtttggttgataagagaaggtgtttcttgaagaatttctgatcatt 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||    
T  23896803 ttacagataactcttttcttgacgagtgcaatgagcttgtgacgaggtgtttgcgtttggttgataagagaaggtgtttcttgaagaatttctgatcctt 23896902  T
Q  201 cgagattagagaattccctgacttgcagacgcagcggaattgcaggaggaacttaacggggagtctacacaggatttcaaccacgagatcaaacggaata 300  Q
    ||||||||||||||||| |||||||||||||||||||||||| ||||||||||| || |||||||| |||||||||||||||||||||||||||||||||    
T  23896903 cgagattagagaattccatgacttgcagacgcagcggaattgtaggaggaacttgacagggagtctgcacaggatttcaaccacgagatcaaacggaata 23897002  T
Q  301 tgagtcaccggtgctgggagaagtagctgcctcttgtttg 340  Q
    |||||||||||||| ||||||||  |||||||||||||||    
T  23897003 tgagtcaccggtgcagggagaagccgctgcctcttgtttg 23897042  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 66; E-Value: 5e-29
Query Start/End: Original strand, 170 - 303
Target Start/End: Original strand, 25611722 - 25611855
Alignment:
Q  170 gaaggtgtttcttgaagaatttctgatcattcgagattagagaattccctgacttgcagacgcagcggaattgcaggaggaacttaacggggagtctaca 269  Q
    |||||||||||||||  || ||  |||||||||| ||||||||||||| ||||||||||||||| | |||||| ||||||||||| || ||||| |||||    
T  25611722 gaaggtgtttcttgacaaaattgggatcattcgatattagagaattccatgacttgcagacgcaacagaattgaaggaggaacttgaccgggagcctaca 25611821  T
Q  270 caggatttcaaccacgagatcaaacggaatatga 303  Q
     ||||||||||| |||| ||||||||||| ||||    
T  25611822 aaggatttcaacgacgacatcaaacggaacatga 25611855  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 138 - 307
Target Start/End: Complemental strand, 24512401 - 24512229
Alignment:
Q  138 tgtgacgaggtgtttgcgtttggttgataaga---gaaggtgtttcttgaagaatttctgatcattcgagattagagaattccctgacttgcagacgcag 234  Q
    |||||| ||||||||||||||||||| | | |   |||||| ||| |||  |||||   |||| || ||||| |||||||||| |||||||||||||||     
T  24512401 tgtgacaaggtgtttgcgtttggttgttgacatgcgaaggtattttttggcgaattcgagatcttttgagatcagagaattccatgacttgcagacgcat 24512302  T
Q  235 cggaattgcaggaggaacttaacggggagtctacacaggatttcaaccacgagatcaaacggaatatgagtca 307  Q
    | |||||||| |||||||||  | ||||||||||| || ||||||  ||||||||||||| ||||||||||||    
T  24512301 ccgaattgcacgaggaacttggcagggagtctacatagaatttcagtcacgagatcaaacagaatatgagtca 24512229  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 170 - 278
Target Start/End: Original strand, 24234114 - 24234222
Alignment:
Q  170 gaaggtgtttcttgaagaatttctgatcattcgagattagagaattccctgacttgcagacgcagcggaattgcaggaggaacttaacggggagtctaca 269  Q
    |||||||||| |||  ||||||  ||||||| ||||| || ||||||| |||||| ||||| ||||||||||| |||||||| || || |||||||||||    
T  24234114 gaaggtgttttttggtgaatttaggatcattagagataagcgaattccatgacttacagacacagcggaattgtaggaggaatttgacagggagtctaca 24234213  T
Q  270 caggatttc 278  Q
    || ||||||    
T  24234214 caagatttc 24234222  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #5
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 202 - 294
Target Start/End: Original strand, 24635570 - 24635662
Alignment:
Q  202 gagattagagaattccctgacttgcagacgcagcggaattgcaggaggaacttaacggggagtctacacaggatttcaaccacgagatcaaac 294  Q
    ||||| |||||||||| ||||||||||||||| | |||||||| |||||||||  | ||||||||||| || ||||||  || ||||||||||    
T  24635570 gagatcagagaattccatgacttgcagacgcatcagaattgcatgaggaacttggcagggagtctacatagaatttcagtcatgagatcaaac 24635662  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #6
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 202 - 311
Target Start/End: Original strand, 24247301 - 24247410
Alignment:
Q  202 gagattagagaattccctgacttgcagacgcagcggaattgcaggaggaacttaacggggagtctacacaggatttcaaccacgagatcaaacggaatat 301  Q
    ||||| ||||||||||   |||||||||||||||||||| | | |||  |||| || |||||||| |||||||||||| |||||| ||| |||||||  |    
T  24247301 gagatgagagaattccacaacttgcagacgcagcggaatcgtaagagacacttgacagggagtctgcacaggatttcagccacgacatccaacggaagtt 24247400  T
Q  302 gagtcaccgg 311  Q
    ||| ||||||    
T  24247401 gagccaccgg 24247410  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #7
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 194 - 279
Target Start/End: Original strand, 25869445 - 25869530
Alignment:
Q  194 gatcattcgagattagagaattccctgacttgcagacgcagcggaattgcaggaggaacttaacggggagtctacacaggatttca 279  Q
    ||||||| |||||||||||||||| ||||||||| | |||||||| ||||| |||||| || | ||||| ||| || |||||||||    
T  25869445 gatcatttgagattagagaattccatgacttgcaaatgcagcggagttgcatgaggaatttgatggggaatctgcataggatttca 25869530  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #8
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 358 - 414
Target Start/End: Original strand, 23897129 - 23897185
Alignment:
Q  358 agtgaatcactaggtgttagggtttcggtttcggtggtcgctcggtgttgctttgtg 414  Q
    |||||||||||| ||||||||||||||||   ||||||||||| |||||||||||||    
T  23897129 agtgaatcactatgtgttagggtttcggtggaggtggtcgctcagtgttgctttgtg 23897185  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #9
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 202 - 298
Target Start/End: Complemental strand, 51831702 - 51831606
Alignment:
Q  202 gagattagagaattccctgacttgcagacgcagcggaattgcaggaggaacttaacggggagtctacacaggatttcaaccacgagatcaaacggaa 298  Q
    ||||| ||||| |||| |||||||||||| || |||| ||| ||||| || || || ||||| |  ||||||||| | |||||||||||||||||||    
T  51831702 gagataagagagttccatgacttgcagacacaacggagttgaaggagaaatttcactgggagccggcacaggattactaccacgagatcaaacggaa 51831606  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #10
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 202 - 271
Target Start/End: Original strand, 45693643 - 45693712
Alignment:
Q  202 gagattagagaattccctgacttgcagacgcagcggaattgcaggaggaacttaacggggagtctacaca 271  Q
    ||||||||||||||||  |||||||| | |||||||| ||| || || ||||| || |||||||||||||    
T  45693643 gagattagagaattccacgacttgcatatgcagcggagttgtagaagaaacttgaccgggagtctacaca 45693712  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0015 (Bit Score: 58; Significance: 3e-24; HSPs: 1)
Name: scaffold0015
Description:

Target: scaffold0015; HSP #1
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 194 - 295
Target Start/End: Original strand, 41133 - 41234
Alignment:
Q  194 gatcattcgagattagagaattccctgacttgcagacgcagcggaattgcaggaggaacttaacggggagtctacacaggatttcaaccacgagatcaaa 293  Q
    ||||||| |||||||||||||||| ||||||||||||||| |||||||| |||||||| || || ||||||| ||| ||||||||| |||| ||||||||    
T  41133 gatcatttgagattagagaattccatgacttgcagacgcaacggaattgtaggaggaatttcacagggagtcgacataggatttcagccacaagatcaaa 41232  T
Q  294 cg 295  Q
    ||    
T  41233 cg 41234  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 55; Significance: 2e-22; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 170 - 300
Target Start/End: Original strand, 1421900 - 1422030
Alignment:
Q  170 gaaggtgtttcttgaagaatttctgatcattcgagattagagaattccctgacttgcagacgcagcggaattgcaggaggaacttaacggggagtctaca 269  Q
    |||||||||| |||  ||||||  ||||||| ||||||||| ||||||  ||||| |||||||| |||||||| |||||||| || || |||||||||||    
T  1421900 gaaggtgttttttggcgaatttgggatcatttgagattagaaaattccacgacttacagacgcaacggaattgtaggaggaatttcactgggagtctaca 1421999  T
Q  270 caggatttcaaccacgagatcaaacggaata 300  Q
    || ||||||   |||||||||||||||||||    
T  1422000 caagatttctttcacgagatcaaacggaata 1422030  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold1004 (Bit Score: 35; Significance: 0.0000000002; HSPs: 1)
Name: scaffold1004
Description:

Target: scaffold1004; HSP #1
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 220 - 278
Target Start/End: Complemental strand, 1455 - 1397
Alignment:
Q  220 gacttgcagacgcagcggaattgcaggaggaacttaacggggagtctacacaggatttc 278  Q
    ||||||||||||||||| ||||| ||||| || || ||||| |||||||||||||||||    
T  1455 gacttgcagacgcagcgaaattgaaggagtaatttcacgggaagtctacacaggatttc 1397  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 32; Significance: 0.00000001; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 208 - 275
Target Start/End: Original strand, 1941334 - 1941401
Alignment:
Q  208 agagaattccctgacttgcagacgcagcggaattgcaggaggaacttaacggggagtctacacaggat 275  Q
    ||||||||||  |||||||| ||||| |||||||| ||||| | ||| |||||||||||||| |||||    
T  1941334 agagaattccacgacttgcaaacgcaccggaattgaaggagaagcttcacggggagtctacagaggat 1941401  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 194 - 298
Target Start/End: Complemental strand, 43991346 - 43991242
Alignment:
Q  194 gatcattcgagattagagaattccctgacttgcagacgcagcggaattgcaggaggaacttaacggggagtctacacaggatttcaaccacgagatcaaa 293  Q
    ||||||||||||| ||||| ||||  |||||||||| |||  ||| ||||| ||| | ||| || || | |||||||||||||||  |||| || |||||    
T  43991346 gatcattcgagataagagatttccaggacttgcagatgcattggagttgcatgagtatcttcaccggtaatctacacaggatttcttccacaagttcaaa 43991247  T
Q  294 cggaa 298  Q
    |||||    
T  43991246 cggaa 43991242  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0760 (Bit Score: 31; Significance: 0.00000004; HSPs: 1)
Name: scaffold0760
Description:

Target: scaffold0760; HSP #1
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 220 - 278
Target Start/End: Complemental strand, 3949 - 3891
Alignment:
Q  220 gacttgcagacgcagcggaattgcaggaggaacttaacggggagtctacacaggatttc 278  Q
    ||||||||||||||||| ||||| ||||| || || ||||| || ||||||||||||||    
T  3949 gacttgcagacgcagcgaaattgaaggagtaatttcacgggaagcctacacaggatttc 3891  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University