View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1339_low_68 (Length: 208)

Name: NF1339_low_68
Description: NF1339
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1339_low_68
NF1339_low_68
[»] chr5 (1 HSPs)
chr5 (1-124)||(42453912-42454035)


Alignment Details
Target: chr5 (Bit Score: 120; Significance: 1e-61; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 120; E-Value: 1e-61
Query Start/End: Original strand, 1 - 124
Target Start/End: Original strand, 42453912 - 42454035
Alignment:
Q  1 tgtttggtttctttattttctaaggcatccaatgttccgttcaccttttcctccattttatgaaaattggattcgaaggatgccttcaaaattagatagc 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  42453912 tgtttggtttctttattttctaaggcatccaatgttccgttcaccttttcctccattttatgaaaattggattcgaaggatgccttcaaaattagatagc 42454011  T
Q  101 atgatatgaaaatgcagccctatg 124  Q
    |||||||||||||||||| |||||    
T  42454012 atgatatgaaaatgcagctctatg 42454035  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University