View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1339_low_48 (Length: 259)

Name: NF1339_low_48
Description: NF1339
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1339_low_48
NF1339_low_48
[»] chr1 (1 HSPs)
chr1 (125-249)||(11402851-11402976)


Alignment Details
Target: chr1 (Bit Score: 118; Significance: 3e-60; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 118; E-Value: 3e-60
Query Start/End: Original strand, 125 - 249
Target Start/End: Original strand, 11402851 - 11402976
Alignment:
Q  125 gtggaattttcaagtctttgtcatgaccgcaaa-tggtctcaaatgatttttccaaatcatgacctctttatctccttttttgaggaaatgacctcttat 223  Q
    ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  11402851 gtggaattttcaagtctttgtcatgaccgcaaaatggtctcaaatgatttttccaaatcatgacctctttatctccttttttgaggaaatgacctcttat 11402950  T
Q  224 ctcatactcatatggtgtgttctctg 249  Q
    ||||||||||||||||||||||||||    
T  11402951 ctcatactcatatggtgtgttctctg 11402976  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University