View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13397_low_5 (Length: 237)

Name: NF13397_low_5
Description: NF13397
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13397_low_5
NF13397_low_5
[»] chr4 (1 HSPs)
chr4 (142-226)||(12931151-12931236)


Alignment Details
Target: chr4 (Bit Score: 66; Significance: 3e-29; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 142 - 226
Target Start/End: Complemental strand, 12931236 - 12931151
Alignment:
Q  142 tgttgtgttttgatgtaaatacatatttggttaatggtgatgaaaagatggatctagaaatggtatgtt-ggtggcgatgatgatg 226  Q
    |||||||||||||||||||||||||||||||||||| || ||| ||||||||||||||||||||||||| ||||||||||||||||    
T  12931236 tgttgtgttttgatgtaaatacatatttggttaatgatggtgagaagatggatctagaaatggtatgttgggtggcgatgatgatg 12931151  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University