View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13393_low_26 (Length: 210)

Name: NF13393_low_26
Description: NF13393
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13393_low_26
NF13393_low_26
[»] chr3 (1 HSPs)
chr3 (19-196)||(34705665-34705843)


Alignment Details
Target: chr3 (Bit Score: 136; Significance: 4e-71; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 136; E-Value: 4e-71
Query Start/End: Original strand, 19 - 196
Target Start/End: Original strand, 34705665 - 34705843
Alignment:
Q  19 gacatggaaggaatgatggctacattttggcgatgaaacnnnnnnnnn-aagaaaggttttgaaacttgtttggagagctcaatgaaaataattatttca 117  Q
    |||||||||||||||||||||||||||||||||||||||          ||||||||||||||||||| |||||||||||||||||||||||||||||||    
T  34705665 gacatggaaggaatgatggctacattttggcgatgaaacttttttttttaagaaaggttttgaaacttatttggagagctcaatgaaaataattatttca 34705764  T
Q  118 agtgttgcttgttttttatcgagtcttcgtgaatatatgctaataaattggatcaatttattgttggtattgtttgtat 196  Q
    |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||    
T  34705765 agtgttgcttgttttttatcgagtcttcgtgaatatatgctaataagttggatcaatttattgttggtattgtttgtat 34705843  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University