View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13374_high_12 (Length: 341)

Name: NF13374_high_12
Description: NF13374
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13374_high_12
NF13374_high_12
[»] chr4 (1 HSPs)
chr4 (13-321)||(32162572-32162880)


Alignment Details
Target: chr4 (Bit Score: 301; Significance: 1e-169; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 301; E-Value: 1e-169
Query Start/End: Original strand, 13 - 321
Target Start/End: Complemental strand, 32162880 - 32162572
Alignment:
Q  13 aatatcacgtaattgagacgctgttttaagcagaatggagaaaacgacgaggtcgttgaaggaaccgagagtggttcgcgcaaggttgtagaatgaaacg 112  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  32162880 aatatcacgtaattgagacgctgttttaagcagaatggagaaaacgacgaggtcgttgaaggaaccgagagtggttcgcgcaaggttgtagaatgaaacg 32162781  T
Q  113 acgtgggagtggatgtcgttaaggaaatgccaacgaatgatgagtttgaaggagtggtgggttggtgagggaagacggtggaagagagtgcgagcgtggc 212  Q
    ||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  32162780 acgtgggagtggacgtcgttgaggaaatgccaacgaatgatgagtttgaaggagtggtgggttggtgagggaagacggtggaagagagtgcgagcgtggc 32162681  T
Q  213 ggaggaagccgaaggaggcgtagagagagatgagggtggtgtcgggaggatggccggagatgatgagggaagcgtggagggttttgacggtggtgggatg 312  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  32162680 ggaggaagccgaaggaggcgtagagagagatgagggtggtgtcgggaggatggccggagatgatgagggaagcgtggagggttttgacggtggtgggatg 32162581  T
Q  313 tttgcagat 321  Q
    |||||||||    
T  32162580 tttgcagat 32162572  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University