View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13366_low_34 (Length: 293)

Name: NF13366_low_34
Description: NF13366
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13366_low_34
NF13366_low_34
[»] chr1 (2 HSPs)
chr1 (148-276)||(33782475-33782603)
chr1 (1-57)||(33782328-33782384)


Alignment Details
Target: chr1 (Bit Score: 129; Significance: 8e-67; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 129; E-Value: 8e-67
Query Start/End: Original strand, 148 - 276
Target Start/End: Original strand, 33782475 - 33782603
Alignment:
Q  148 cggcgggtattgtttgtttgcatggggcgttgaagaggacggatgttggtggtttggatgattatgaatcgccgtatggtcctatgctagctactgatac 247  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  33782475 cggcgggtattgtttgtttgcatggggcgttgaagaggacggatgttggtggtttggatgattatgaatcgccgtatggtcctatgctagctactgatac 33782574  T
Q  248 tgctggtccttatgcacctgtttgatatt 276  Q
    |||||||||||||||||||||||||||||    
T  33782575 tgctggtccttatgcacctgtttgatatt 33782603  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 57; E-Value: 8e-24
Query Start/End: Original strand, 1 - 57
Target Start/End: Original strand, 33782328 - 33782384
Alignment:
Q  1 tctcacgtgactccgatgagcctctgtcgctgttcaacgtcgtggcggttgatgatc 57  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  33782328 tctcacgtgactccgatgagcctctgtcgctgttcaacgtcgtggcggttgatgatc 33782384  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University