View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13360_low_12 (Length: 202)

Name: NF13360_low_12
Description: NF13360
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13360_low_12
NF13360_low_12
[»] chr5 (1 HSPs)
chr5 (47-185)||(29092565-29092697)


Alignment Details
Target: chr5 (Bit Score: 112; Significance: 8e-57; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 112; E-Value: 8e-57
Query Start/End: Original strand, 47 - 185
Target Start/End: Original strand, 29092565 - 29092697
Alignment:
Q  47 tatcaattggattcccttatgagaaggttcagcaagacagttcttcttcaagttttatcttgccctttcaacttcaagtgacaatttttctcttagttgc 146  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||      ||||||||||||||||||||||||||||    
T  29092565 tatcaattggattcccttatgagaaggttcagcaagacagttcttcttcaagtattatcttgccct------ttcaagtgacaatttttctcttagttgc 29092658  T
Q  147 cacaatctctatgttagtaccaaagacatgggcactgat 185  Q
    |||||||||||||||||||||||||||||||||||||||    
T  29092659 cacaatctctatgttagtaccaaagacatgggcactgat 29092697  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University