View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13354_low_16 (Length: 218)

Name: NF13354_low_16
Description: NF13354
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13354_low_16
NF13354_low_16
[»] chr7 (2 HSPs)
chr7 (3-110)||(45908855-45908962)
chr7 (146-201)||(45908764-45908819)


Alignment Details
Target: chr7 (Bit Score: 108; Significance: 2e-54; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 108; E-Value: 2e-54
Query Start/End: Original strand, 3 - 110
Target Start/End: Complemental strand, 45908962 - 45908855
Alignment:
Q  3 atatatgttcgatttaattctaaagtgtcgatactacgtagtagccaaaccttcatatggtatggtattattacaaagaaagatttaagtctaagctatt 102  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  45908962 atatatgttcgatttaattctaaagtgtcgatactacgtagtagccaaaccttcatatggtatggtattattacaaagaaagatttaagtctaagctatt 45908863  T
Q  103 atcacttg 110  Q
    ||||||||    
T  45908862 atcacttg 45908855  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 146 - 201
Target Start/End: Complemental strand, 45908819 - 45908764
Alignment:
Q  146 ggtgtcactgttgtagtggttgcacttgcagctacttcttcttgcacatattcttt 201  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  45908819 ggtgtcactgttgtagtggttgcacttgcagctacttcttcttgcacatattcttt 45908764  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University