View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13349_low_7 (Length: 247)

Name: NF13349_low_7
Description: NF13349
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13349_low_7
NF13349_low_7
[»] chr1 (1 HSPs)
chr1 (67-198)||(991272-991403)


Alignment Details
Target: chr1 (Bit Score: 124; Significance: 7e-64; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 124; E-Value: 7e-64
Query Start/End: Original strand, 67 - 198
Target Start/End: Complemental strand, 991403 - 991272
Alignment:
Q  67 catgtcctctccttcccctcgtaatcgcctcaatcaggtccttctctatccccatttccacttcccccaaaccctagaatttcgcattatagggtaacga 166  Q
    ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||    
T  991403 catgtcctctccttcccctcgcaatcgcctcaatcaggtccttctctatccccatttccacttcccccaaaccctagaatttcgcattctagggtaacga 991304  T
Q  167 ttattgaagtattcaattctccaatgtcgctg 198  Q
    ||||||||||||||||||||||||||||||||    
T  991303 ttattgaagtattcaattctccaatgtcgctg 991272  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University