View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13338_low_36 (Length: 229)

Name: NF13338_low_36
Description: NF13338
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13338_low_36
NF13338_low_36
[»] chr4 (1 HSPs)
chr4 (1-161)||(1746981-1747141)


Alignment Details
Target: chr4 (Bit Score: 153; Significance: 3e-81; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 1 - 161
Target Start/End: Original strand, 1746981 - 1747141
Alignment:
Q  1 atcaaatccagatgatacaattcaagggaaagcaaagaaaaacaatgtaatttataactttgtataacacataactaattgcattatattgcacattata 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||    
T  1746981 atcaaatccagatgatacaattcaagggaaagcaaagaaaaacaatgtaatttataactttgtataacacataactaattgcattatattgcaccttata 1747080  T
Q  101 taaaaatcttaacatacaagattactaggaaattatggtgcatagagtaataatcaaatac 161  Q
    ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||    
T  1747081 taaaaatcttaccatacaagattactaggaaattatggtgcatagagtaataatcaaatac 1747141  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University