View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13336_low_17 (Length: 231)

Name: NF13336_low_17
Description: NF13336
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13336_low_17
NF13336_low_17
[»] scaffold0771 (1 HSPs)
scaffold0771 (15-177)||(3155-3316)
[»] chr3 (1 HSPs)
chr3 (15-177)||(13951015-13951176)
[»] chr8 (1 HSPs)
chr8 (162-203)||(42500790-42500831)


Alignment Details
Target: scaffold0771 (Bit Score: 115; Significance: 1e-58; HSPs: 1)
Name: scaffold0771
Description:

Target: scaffold0771; HSP #1
Raw Score: 115; E-Value: 1e-58
Query Start/End: Original strand, 15 - 177
Target Start/End: Complemental strand, 3316 - 3155
Alignment:
Q  15 aatatatagtactacggtttagattacaacagtatcactaaatcgtactgtgcaataacgacgattaggcctaacacacgtttagggtcaaacacaaggg 114  Q
    ||||||||||||||||||||||||||||||| |||| ||||||||||||| |||| || || ||||||||||||||||||||| ||||||||| ||||||    
T  3316 aatatatagtactacggtttagattacaacaatatccctaaatcgtactgcgcaacaatgaagattaggcctaacacacgttt-gggtcaaacgcaaggg 3218  T
Q  115 tatgggtggagggagctcttcacaatgctctgctagctcagctttgtctccgccccttgcccc 177  Q
    || ||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||    
T  3217 taggggcggagggagctcttcacaatgctctgctagctcagcttcgtctccgccccttgcccc 3155  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 115; Significance: 1e-58; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 115; E-Value: 1e-58
Query Start/End: Original strand, 15 - 177
Target Start/End: Complemental strand, 13951176 - 13951015
Alignment:
Q  15 aatatatagtactacggtttagattacaacagtatcactaaatcgtactgtgcaataacgacgattaggcctaacacacgtttagggtcaaacacaaggg 114  Q
    ||||||||||||||||||||||||||||||| |||| ||||||||||||| |||| || || ||||||||||||||||||||| ||||||||| ||||||    
T  13951176 aatatatagtactacggtttagattacaacaatatccctaaatcgtactgcgcaacaatgaagattaggcctaacacacgttt-gggtcaaacgcaaggg 13951078  T
Q  115 tatgggtggagggagctcttcacaatgctctgctagctcagctttgtctccgccccttgcccc 177  Q
    || ||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||    
T  13951077 taggggcggagggagctcttcacaatgctctgctagctcagcttcgtctccgccccttgcccc 13951015  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 162 - 203
Target Start/End: Complemental strand, 42500831 - 42500790
Alignment:
Q  162 ctccgccccttgcccctcttctatgtaaatatatgagccata 203  Q
    ||||||||||||||||||||||||||  ||||| ||||||||    
T  42500831 ctccgccccttgcccctcttctatgtgtatataggagccata 42500790  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University