View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13332_low_4 (Length: 252)

Name: NF13332_low_4
Description: NF13332
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13332_low_4
NF13332_low_4
[»] chr3 (1 HSPs)
chr3 (84-233)||(350492-350641)


Alignment Details
Target: chr3 (Bit Score: 134; Significance: 7e-70; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 134; E-Value: 7e-70
Query Start/End: Original strand, 84 - 233
Target Start/End: Original strand, 350492 - 350641
Alignment:
Q  84 caattaatctatgttattttctgtttaggactgtaagaagacttttccttcagctttatgtttgggaggctcattgcaagctgtcacacgttctattcgc 183  Q
    |||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  350492 caattaatctatcttgttttctgtttaggactgtaagaagacttttccttcagctttatgtttgggaggctcattgcaagctgtcacacgttctattcgc 350591  T
Q  184 ggccacggtaatgaattaacttcatccactgccttactctacattgcagt 233  Q
    |||||||||||| ||||||||||||||| |||||||||||||||||||||    
T  350592 ggccacggtaattaattaacttcatccagtgccttactctacattgcagt 350641  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University