View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13320_low_8 (Length: 287)

Name: NF13320_low_8
Description: NF13320
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13320_low_8
NF13320_low_8
[»] chr1 (1 HSPs)
chr1 (4-276)||(16512360-16512632)


Alignment Details
Target: chr1 (Bit Score: 233; Significance: 1e-129; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 4 - 276
Target Start/End: Complemental strand, 16512632 - 16512360
Alignment:
Q  4 gggggcgagtacttttctcatagcaattttataatttacacacaattgttcctgataattaacctgaagtggtgttccagttagacaccagcggcagtgt 103  Q
    ||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||     
T  16512632 gggggcgagtacttttctcatagcaattttataatttacacgcaattgttcctggtaattaacctgaagtggtgttccagttagacaccagcggcagtgc 16512533  T
Q  104 gacgacagagcaatagcagcctcagcaacctggcttttatgggattttatatgatgagcttcgtctagcaccactctgtaccattggaccctgtggtaga 203  Q
    ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||    
T  16512532 gacgatagagcaatagcagcctcagcaacctggcttttatgggattttatatgatgagcttcgtctagtaccactctgtaccattggaccctgtggtaga 16512433  T
Q  204 tgctattctctctttcctggtttcagaaatcaggaaactcaatgtaaagaaacttcactgagcaaattaacga 276  Q
    ||||||||||||||||||||||||| ||| |||||||| ||||||||||||||||||||| ||||||| ||||    
T  16512432 tgctattctctctttcctggtttcaaaaaacaggaaacccaatgtaaagaaacttcactgtgcaaattgacga 16512360  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University