View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1331_low_20 (Length: 316)

Name: NF1331_low_20
Description: NF1331
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1331_low_20
NF1331_low_20
[»] chr3 (1 HSPs)
chr3 (96-238)||(5968826-5968968)


Alignment Details
Target: chr3 (Bit Score: 92; Significance: 1e-44; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 92; E-Value: 1e-44
Query Start/End: Original strand, 96 - 238
Target Start/End: Original strand, 5968826 - 5968968
Alignment:
Q  96 ttataacttggtttgcatccacgacctgcaaccaagtccagttatagttttactgatatgttcggtactatttttgtataattgaatttataaatatctg 195  Q
    ||||||||||||||||||||||||||||||||||||||||| ||  |||||||||||||| |  ||||||||||||| || ||||||||||||||| |||    
T  5968826 ttataacttggtttgcatccacgacctgcaaccaagtccagctaatgttttactgatatg-tatgtactatttttgtctagttgaatttataaataactg 5968924  T
Q  196 aattgtacta-taggaataatttggcataatctatattaatact 238  Q
    ||| |||||| |||||||||||||||||||||||||||||||||    
T  5968925 aatggtactattaggaataatttggcataatctatattaatact 5968968  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University